Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:314D10   

TH:314D10RNAiTH:314D10
PCR_productTH:314D10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05H8.1b Source_evidenceePCR205WS150 Sequence/Annotation Release
Overlaps_Gene C05H8.1 (3)
Overlaps_transcriptC05H8.1b Source_evidenceePCR205WS150 Sequence/Annotation Release
WB_DNA_textTH:314D101316ccatcagacccaccttctatgctcttctcgaaaactttttcatattttcaggatggtgggcgacacgtcagatgattcgccgggtccctcctcaacagttagcacaatgacaacaactggaactgttgacaggcggtcactactgtcagcagcttcaatggttcgacaacaatcagatacaacaggtgtacggaggcttgtgagagctcgagccgtgcaagaagatgatgaagccggacctcattctagtaataatgtgagtttttagagggtttatcacagaagaaatatatagttttttgaaaatataaatattagataatttataaaaaatgagcaaaattgtttgaaaagagttaaactttattttctgaaaaaaattttagacttaattttcgagaattgagaaaaaattttcaaaattcaaaatataaaggtttataagaattttaaaaaccgacaaaaaaattggtggaaaaaatttcagaaatcatttttaattgattttaatttttttttattgttcaagtactttcttgcacattttaaaaattccaacttataatacatacctaaaacctccctaagccacattaatcctgatctctggaacaaaacaaactagactaccatactcagttcattctcattatctagacagttgattacataatttttcaataaaatttctaccctttgggaatttctatttttgtatattaaaattgtttcctattatacttacattgcttttctggacgaataggactttttggttttttgttggcattttttatgtttattttaatgaatagaaattccaacaaagacagattttcaaaataagtatttaaattcgaaataaaaatatgtttacgttccactaaactaacgaaatcttgtgataaacggaaaatgatcactattttgaaaacaagactgcttaactaaagtcctatcgattttaagtcaaaacttcaaattttcttccttttctagcatatttcaccaagcagccgacacttcatgagtgggtgcacagagaaactatctaggccctcagcagccgacgcctccccggtcccacgcgtgtcaaatttttcaatgttaagtactcaagtagcgtttttgggcttttgggcttcgtgcttattgtggattcttcggccacggccaccaccaaaaattatatcccatatgcgacatcacctaacttacactcttccgggttaaatgtctatgttttgaaaacaatgtttttttgaattctcaagagtaacacttcccacgtgataagaatatcctccgccagatgt