Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:314e3   

TH:314e3RNAiTH:314e3
PCR_productTH:314e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20H4.3b Source_evidenceePCR1207WS150 Sequence/Annotation Release
Overlaps_Gene T20H4.3 Source_evidenceePCR1484WS150 Sequence/Annotation Release
Chunk_score Abs_score1400
Max_abs_score1400T20H4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII72392307240921
Overlaps_transcript T20H4.3a.1 Source_evidenceePCR1484WS150 Sequence/Annotation Release
T20H4.3b Source_evidenceePCR1374WS150 Sequence/Annotation Release
T20H4.3a.2 Source_evidenceePCR1484WS150 Sequence/Annotation Release
WB_DNA_textTH:314e31692gtacgcagctccaaatgctcgtcaatccaaaccaaagaaggaagagaaaccaaaacaacagccaaagcaacaagaaaagaaacaagatggaaagaagcagacattgttaggagttggaaccaagaaagatgataactattcggaatggtacagtgaagttatcactaaggcagaaatgatcgaatactatgatgtatctggttgctatgttcttagaccatggtcatttgcagtttgggaatctattcaagaatggtttgattctggaattaagaaattaggagtgaagaactgctacttcccaatgttcgtatcaaatgctgccctcgaacgcgaaaagactcatattgctgattttgccccagaagttgcttgggttactcgtgctggaaactctgaaatggccgaaccaatcgctattcgcccaacttcagagacagttatgtacccatcttacaagaaatgggttcaatctcatcgcgatcttccaatcaagttgaaccaatggtgcaatgttgttgtaagtattgattttttaattgaaattagttaaaaatttttataaatttctgttgaatttctcctagctgtcttgctccactgcaaaaatattatcataatacttttttcctttacagcgatgggagttcaagcatccaacaccattccttcgtactcgtgaatttctctggcaagagggacatacggcttttgccaacccagcagacgctgaaaaagaggttttccaaatccttgatctctacgcaggagtctacactgatttgctcgctatcccagttgtgaagggacgaaagagtgagaaggaaaagtttgctggaggagattttacgacgacagtcgaagcatacgtggcatgcaatggtagaggaatccaaggagcaacttctcaccatctcggacaaaatttctccaagatgtttgatatttcgtacgaggatccagcgaaggaaggagaacgagcattcgcttggcaaaattcgtggggtctttccactcgtaccattggtgcaatggtaatgattcacggagatgacaagggattagtacttccaccaagagttgccgctgttcaagttattgttgttccagttggattcaagactgagaacaagcaatcgcttttcgatgctgttgataaggttaccaaggatttggtcgcggatggagtaaaggctgagcacgatttgaggtttgaaattaataatgaatgcagttatgtacgtttttaattacagagaaaactacaatgctggctggaagttcaatcattgggaattgaaaggagtcccaatccgttttgaggtcggaccaaatgatttggcaaagaaccaggtaaccgctgtaatccgtcacaacggagagaagaaacaactttccctggaaggactgtctaaaactgtcaaatctcttcttgatgaaattcatactgctatgtacaataagttggttaaaatttttaaaagttgaaataaattccatacttcagggtactcgctcaacgtgactctcacctgaagagcaccacgtgcatcgaagaattcaagaagcttcttgacgagaagtgcattatactgtccccattctgtggtcgtccagactgtgaagaggaaatcaagaaggcatcaacaagagaagacggagaaggcgcacagatgggagccaagacgttat