Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:320C11   

TH:320C11RNAiTH:320C11
PCR_productTH:320C11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K01G5.5 Source_evidenceePCR1054WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII1074885510750015
Overlaps_transcript K01G5.5.2 Source_evidenceePCR902WS150 Sequence/Annotation Release
K01G5.5.1 Source_evidenceePCR1054WS150 Sequence/Annotation Release
WB_DNA_textTH:320C111161agctccacgaggaagttgaggatgatcgcaaggtgaagcaagccctcgagaagctcaccggagccctcttccaacgcccaccactgatctcagctgtcaagcgtcagcttcgtattcgtaccgtttacgagaacaagttcatcgagtatgatccagctcaacagatgggaattttcaagtaagaatccttataataaatctaatttctagttttcatttaatttcagctgcatctgcgagtcgggaacctacgttcgtacaatttgtgtgcatctcggtctcatcctcggatgcggaggtcaaatgcaagagcttcgcagaaacagatccggaatctgcgatgaaaacgagaatatggtcacaatgcacgacgttctcgatgctcagtatctcctagacacccagaaagacgagagctacatgagacacatcgttcgtccacttgaggctcttctcacccagcacaagagagttgttgtcaaggacagttgcatcaacgcgatctgctacggagccaagatccttattcccggaattcttcgttacgacgatgacatcgaggttggcaaggagatcgtcatcatgtcgacgaagggagaagccatctgcatcgctattgctcagatgaacacatcaacgatcgcttcagtcgatcacggagtcgttgccaagtcgaagcgtgtcattatggagcgtgatgtgtacggaagaaagtggggacttggaccggttgcatccaagaagaagcaaatggtcaaggacggacttctagacaaattcggaaaaccaaatgacactactccaaaatcgtgggccaaggagtacgttcaaacttcgacgaagaaagaagtcaagaaagaggagacgccagacgaggaagaggaggaggcaccgaagaagaaatccaaaaagtccaagaagcaagagtcgagtgatagtgatagcgattaagctcatttttatgttttttcttttttaaattacctctgttgactatttacttgttgttcaaaaatctttttgttgttattcattctaaacatcgttttccttgttgtaccaattttgttgaacatttgaactttatataaatcggattttcgaaagaaaaaacgtgtagagatcaaataacataatttaggagtttccaggcagtgtcga