Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:320C9   

TH:320C9RNAiTH:320C9
PCR_productTH:320C9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F55H2.6 Source_evidenceePCR978WS150 Sequence/Annotation Release
Chunk_score Abs_score936
Max_abs_score936F55H2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII95186759519703
Overlaps_transcript F55H2.6.2 Source_evidenceePCR978WS150 Sequence/Annotation Release
F55H2.6.1 Source_evidenceePCR978WS150 Sequence/Annotation Release
WB_DNA_textTH:320C91029tcgtttcttgccgttcttcttattggctttcttcgcaacgttcgcagcaatagggcttggatccaaaactacagagaataggcagttgagaatgtgagatgtacttgcggagagttgatcagcagtaatttgaacattgatcttgcggatgacatgctttgcagatctagcaacgatatccgaaagaacaagtggacgagcaaatgagacgctgttttcaagacgttttccaatttctcctaaatagcgaatattgataccattgatgtgcataatgtcagcaagattatctccatcaattggttgcacaacgcaatctttcaagttctgaacaagctctggaatcttctgggtaaggaggaaatctgcggcatccacaacaacacggcgttgtcgttcaaggttctctgttggtgcatgtttgacatttgatgagaaacaatccggattgaacttcataacatagcgatcttcataaatagaatgaacaactgcacaagcttccttgatagcatcttgaacgactttgtttttggcttcaaactccttatcttcgctgatggccataaagagtagtgatagttcagtttctgcttcggctgaaaaataaaaataatttgattaagaaaagttttgtacgaaatgattacctgcttgcttaatcaaagtttcatcatttttctcttttgactcggtaatcagatcacggatcttctttgcagttaactggatgaaagtgaccaatctagactcacagaacgcatcaattagttcacggcggagagccgaaagcttgtgcgggaattttcgtggatatcccagtgttttagcggcctcagagacctctgcgtcatcgagataatgaacatctggaggcattgaacgaagaaggtccaaaacgtattttctaccatcgtttccaattattcccttagcttcgtagcttgtataaagcttcaactcttccttaactccgtctttctcgctgataacggtgtgaggcagcattttcagtttgtgagcagcatc