Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:320E1   

TH:320E1RNAiTH:320E1
PCR_productTH:320E1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0464.8 Source_evidenceePCR712WS150 Sequence/Annotation Release
Overlaps_Gene B0464.8 Source_evidenceePCR712WS150 Sequence/Annotation Release
Chunk_score Abs_score607
Max_abs_score607B0464.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII94683199469444
Overlaps_transcriptB0464.8 Source_evidenceePCR712WS150 Sequence/Annotation Release
WB_DNA_textTH:320E11126gattcgaagtgttgtgacgagtttgatgttcacttcgggagacgacgaaaatccactttctgaaaatgaagatttcgttgtgaatatactgaaaaacgagttggttctctttattaacgatgttatagaggtttatgataataagtaagcagattttttttttccgaaataattcaaacatttacagaattccaaatgtgaagctacaacatatgcttcaacttctcaacagtcaaaaaggagtactttctcgttttattaaatatctcaagaatcgtgtggaaatgtcggcattcatgagagcgaaatcattttctaaaaacggaactgaaaatatttgtggacaagaagtagagaatgaagatgaaacggtctgtaaaactgaaaaaaattaaatttagaataattactttcagactgatgaaaagatagaagagggagttgatccaatggatgaaattggtgaagttggtggagaagagggagaatatttgaaaaataagaggttattactattactgtcttaatttgtatttttgggggcaaaaaatcgaatttttgcgtctgaaaatattagaaaatttttgaaatattacaggagaacgtacggtacaattacatccgaggaaaacctgcttcaagaagctcaaaagtcgtttttcgatgctggattagatttcaatacattcgaaaatgatgtggatgagaatcacaatcaacaattaatagttcttcaaacaattctcgaagatatgaacgctgatgaatacagtcgattcgcacttgctcgacgtgtcagtttccagaatcaatcagcagttcctgtggtttatagtgacacattttcaaagtcaaatgcaagaaaaaggtaataatattacacaatgcgaaattttgcggtatccggtcccgaagcgaccggttttcttaaattctatagagcttgcacctttaaggggtactgtagagctaacttttaagtatttcaaaacttttttttctcaatgaacttcaggggaaatgaaagcctctcaaaaattaaagaaaatcgcgcttttttttttgaaggtaaacatttactaacatttttcctaatttcagaaaacgatcgcctccaacaaacaat