Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:320E12   

TH:320E12RNAiTH:320E12
PCR_productTH:320E12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (5)
Overlaps_Gene K08E3.5 Source_evidenceePCR1230WS150 Sequence/Annotation Release
Chunk_score Abs_score1146
Max_abs_score1146K08E3.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1376404013765484
Overlaps_transcript K08E3.5a.1 Source_evidenceePCR1230WS150 Sequence/Annotation Release
K08E3.5d Source_evidenceePCR1155WS150 Sequence/Annotation Release
K08E3.5c Source_evidenceePCR1230WS150 Sequence/Annotation Release
K08E3.5a.3 Source_evidenceePCR1230WS150 Sequence/Annotation Release
K08E3.5e Source_evidenceePCR1230WS150 Sequence/Annotation Release
K08E3.5b Source_evidenceePCR1230WS150 Sequence/Annotation Release
K08E3.5a.2 Source_evidenceePCR1230WS150 Sequence/Annotation Release
K08E3.5f Source_evidenceePCR1230WS150 Sequence/Annotation Release
WB_DNA_textTH:320E121445tgaaccgtcccaggtagtccttgaccttatcgaatgaagatccgagcttcaccagcggtgttgttgggaaggatctttgatgagacagcgtcaaggatccattgtcaatatcgtaaagatttgacattaaaagcagaagatcagaagtcttcttgactggcaagaaacgggaacgtggcacattgactccaacagctccagagaatgacttgatggctgcaccagcggcggtttcgagttgaataacatcaagcccacggtcgagatgcttcggattgacgataacctccatttcgagcttgttttccaccacaatttttctcatggcgtcaagcttggcccacaagttgttagtattgaaaattcggaatttgctaatcgacttgaactcgtccacataatccttcggcacctgagcaatttcaagaagcataagacgtccttcgtactgaatgagagttcctcccttcacgtcagcacgggtcttatcggtgacctccatcaagaactccggagcagtttgatcgggagatgggttcagcacaaaattgagaatagaaagatccacggtagctcccatattgtcaatgttggataggaaacagtattctttgccgtcggcgaggaacttgtccaggagtccagagttgtggaaggcctcgtagaagtttccgtgacctggtgggtaccagcattcgttgtcgtcggcttcgagtgatttgacgattggaagaagagtctcacggttgatacgtgggtattgagattgggagaaggtatgcacggagacctgaaagattgtgtatgaatttaaaatcgaaagtttccgaattcgtattattgtgatgtaagtcgaagatgccataatgcggatatttgaacaaacacctgaatccgaattagaatctcaccttaacgttggcatactttttgagcactttctgagtgtcctcgtttgtattgaacgagttcatgagcacgaggggaacgtcgaccccataggttttgtttaaagtctgtaaaatagagatttaacagaatttcctccgtttcaaggctcacctgaatttgttgcatggtcaagtcaaggaaggtcagatcgttacggacagaaattaccgactttggtcccttgcaccccattgatgtcccgagacctccgttgagcttcaccacgaccaacttgcgaagttgcgaagcgataagttccttgtcgacgacatgaccgagctgaataattgatgtttatttggaatgcttacatttaagtcaacttacacttttgtacggacggatggctccctctggaagaggctcaatcttggaccaatcgacggtgggcttggcacgaagaaagcgagcgaagagattgcggaagcccgatagctctgtcttgttgtgattcaacgtctcaggtttgcaggttgaaagcaggtgagccaact