Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:320H9   

TH:320H9RNAiTH:320H9
PCR_productTH:320H9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF58A4.5 Source_evidenceePCR817WS150 Sequence/Annotation Release
Overlaps_Gene F58A4.5 Source_evidenceePCR817WS150 Sequence/Annotation Release
Chunk_score Abs_score817
Max_abs_score817F58A4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII96061939607061
Overlaps_transcriptF58A4.5 Source_evidenceePCR817WS150 Sequence/Annotation Release
WB_DNA_textTH:320H9869ttttatctcggcatttggcatgagtattgtatagtaaaatccaaaaaattacctgaaagcaaaagtaactgtctctcgttgtgaatcgatgccaaatgtccaccctttccaacacagaacaatcgtgcatcttcaaagttcattggcttttcatatcgtttgaaacaaagtgctggagcagttgcatttgtgttaaattgagtccattctgccggacatgctggatccttttcagattgttttgctacaattgcaattggcagagcatttggtttcactgttgtgatgattgtcgttaaatcggaatttttggttgtcgtggatctctgatttgcaagtgctgcattcagagactcatcaatatcaggttcttctgttgtagtttttgtagactttgggtcttccggcttctttgttggatgtttattttcagaaacgacggctagagccacattcgctgatttctgatccttggattgatcactagagtcgcttttagattttgatgctaaagctgcagaagctgcagcagaagccttctgttccaagttcaatgaagcactatcttcactttcatccttcgaactactctctgacttcttcgaactctttgcactcatcgctgcagccatgaccgcttgttcacttgcctgactggattcagaaattgatgcagattcagaatcagtatttgaactagaactttctcttctctttgagcttctcatagtcatcgctatttgttcagcaattgccatcatcatattcaaagtctcttcatcagtttgagagtcaaaacttgatgtatttgttgttctagaatctgcccaatgtgcatttagaatatatccaccaattaacgaagcagc