Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:320c10   

TH:320c10RNAiTH:320c10
PCR_productTH:320c10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59A2.1a Source_evidenceePCR1348WS150 Sequence/Annotation Release
Overlaps_Gene F59A2.1 Source_evidenceePCR1348WS150 Sequence/Annotation Release
Chunk_score Abs_score1285
Max_abs_score1285F59A2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII34012113402867
Overlaps_transcript (4)
WB_DNA_textTH:320c101657tttcgatacggaaattggcacagagcttatggacttgctcacgacgcatcacgattcgatatttgttgtcattgcttttcaggagctgaaataataaattatttttctcaaatttagcctctatgagtcaaaaatcagttgttttcttaatagttttcattaaaatttagtgaaaaaacatagaaaatacttgcaaaacagttgaaaagtgcgcaaaactagcacttttcttaactgtttcaactgaaataagttattttctacgttttatcactaaattttaatgaaaactatcaaaagaacatgccaagctggctcattttgatataaaatcctaaatctgaccttaatatctccgagtccacgttccttattctccttgagatccgaatagtacttataaagcttgcatctggcggagaacatgacctcctcgtcctcttcaccagttttcacctcaaccaaatccggaagaggaataactggcttaaactcgacttctggctcatactccccatctccatcctcattcgtctcatcaccatcgtgtgaagttgcagaagtcgtgttcaacgtggtgttcttgctcccgaaaatgcttgccttcttctgagcagcaagttcttcttgggccttcttgacatttgctgcgtcgaaaatggagccagatttggcagagttggctgaaagggcagcgaatgttgcacctccagacgtgaatccactaccgaacacggattttggcgtctcggactgtttattttcttcttgtttagctggtgcagtcgttgatggagtctgttgctttccgaatgagaaagttggctttgggaaggcactttcagaattcttggcgaacataaacgacggagtagtagttgaagaagctgtagattcagtcttggagagtccacctccgaacaatgaatttcctggagtcgtagaggttgccggagaagcagttgaagctgcaggattgttgaaattgaacgatggggtagttgcattgacagcggcagctggcttgttgaatgagaaagttggagtattagcagcacctccaccgaaaacgcttgttccctttggtgttccaccaccgaaaatgctactgctagtgcttggagatccgctgagtgatccaccgaactgagatgtttgagcaagaggttccttggctggagcagatgctccgaatccgaatgtcacttttggagttcctggggcaggctggaggatcgaaggtctgcaaatttaaatttttaattttaagataactcaaatagaatatttacttagagaatatatttttctctttgacagatccgtctttcgatgtcccacaacaggcacattcaatctcgtcagctttgcaagtaacatagcatccagggcattcccaagatcctggttttggcttgaactgatctccaaatccagtctcttccggtttgttgtttgatggaatcacaacttcttgcttgacttccttcttcacctcagccgccggcttgatttccttgtcgatggtctttccagcgttgctcgatgattttgcctcagcgacagccttctcgaacaaagtcttaaactctccagcgatatcgacgttagcgaaacgagcggaaagcttcacgtgagctggctgatcttcggaaaa