Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:321B5   

TH:321B5RNAiTH:321B5
PCR_productTH:321B5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST16G12.5 Source_evidenceePCR732WS150 Sequence/Annotation Release
Overlaps_Gene T16G12.5 Source_evidenceePCR732WS150 Sequence/Annotation Release
Chunk_score Abs_score647
Max_abs_score647T16G12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1006439610065315
Overlaps_transcriptT16G12.5 Source_evidenceePCR732WS150 Sequence/Annotation Release
WB_DNA_textTH:321B5920ctgataactcctccaggtatgtaaatttcaataattatctccttgttgtggccttttattgctccgacacgatttatgtcgaaaaaaaatctataaatttatatttaaataagatttgcaatgtaattcgagataaaattttattatttctttaattgcgtcgcgtgaatgaacatattttttcagcagaaacatggaaaaatgatccgtttgagctactggtgaagaaatgcccgaaggtgaggttttttctaaattaaaaattctctatattaagtattcaggatctgtttgaaaagtatgtagacacaccaaacgaagattcaattccatctacttctgatgatgttagaactgtcaatgccgatgtcagaatttactattctcaaattctcggaggtctttatcttgatcttgcgaatttgctcaaatcagaacgtgcgaactgctccgacgaataccagcttttgtcacttcaagatgtcacacttgtgagaaaatcattcgaattcttcttgctcaccggtatcttgccatttatggagcccggtgccggactcggagcagcctcacgcagtacattcatcaaatcgtggaaactatacgatggaaacaaagaaacgtgtattgaaaagcttgagtttgctgcaaaagtgatcataaatcttctggaaagcaatgaatctctcatcggtcaattcttgacaaaattcatcgacgatgtgctcgccgttcgtttccagcttcttcagctgaaaatcgataaatacgagttgaacttcgctgagctggtctcaaaactccaaattgacgttcttttcggatctttgatgtttctgacgcaggataagaagacagcaaagacgccgatgtggttgaaagttgcttgtggcaaacagatgacaaagattcttgtcgga