Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:321C9_3   

TH:321C9_3RNAiTH:321C9_3
PCR_productTH:321C9_3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y20F4.4 Source_evidenceePCR912WS150 Sequence/Annotation Release
F09E5.10 Source_evidenceePCR807WS150 Sequence/Annotation Release
K01A11.5 Source_evidenceePCR852WS150 Sequence/Annotation Release
Y43F4B.2 Source_evidenceePCR917WS150 Sequence/Annotation Release
Overlaps_Gene Y20F4.4 Source_evidenceePCR912WS150 Sequence/Annotation Release
Chunk_score Abs_score768
Max_abs_score768Y20F4.4
Specificity_index0.277
Rel_score1
Map_statusTop85_percentile_ePCRI20373942038590
F09E5.10 Source_evidenceePCR807WS150 Sequence/Annotation Release
Chunk_score Abs_score638
Specificity_index0.23
Rel_score0.831
Map_statusTop85_percentile_ePCRII53480185349214
K01A11.5 Source_evidenceePCR852WS150 Sequence/Annotation Release
Chunk_score Abs_score650
Specificity_index0.235
Rel_score0.846
Map_statusTop85_percentile_ePCRIII34488493450045
Y43F4B.2 Source_evidenceePCR917WS150 Sequence/Annotation Release
Chunk_score Abs_score715
Specificity_index0.258
Rel_score0.931
Map_statusBest_ePCRIII1329349513294691
Overlaps_transcript Y20F4.4 Source_evidenceePCR912WS150 Sequence/Annotation Release
F09E5.10 Source_evidenceePCR807WS150 Sequence/Annotation Release
K01A11.5 Source_evidenceePCR852WS150 Sequence/Annotation Release
Y43F4B.2 Source_evidenceePCR917WS150 Sequence/Annotation Release
WB_DNA_textTH:321C9_31197cttgccttcagcttggaaaattgctgctcactcgggttgtttgtgaactctaatccgtttcgaaccctctctctacagttccaaaaatcaacgggatatcgagcatcttctccaaaatagaatttttcgaggtagctgaagaaatctgaaaaacgagaataattgatttcatgacaagatttttcaaacctttcaatgctggatgaatattaactgttcgacatttcagaagacggagccaaagaagtactttgtcgtgtggagcaaaactgagagtataaatcgattttaaaagattcacgaattccggcttattgatatcgtctccaacagctgaaattttgaattaggttagcagcattaaatatttaggtttaccttttcgcagatttttaaaaagattcactttgaagtgacgccaacatccgaaaatgtccgcattcggccacacagctctgctcgcattaacactggccacttcaaagtctggataggttgataaatttaataaatataaccaacgtttacctgaaaatacgtattttggttggattccactacgtaggaaagataggaacaaacgtctgtacaaatcttctttggcagagccacacaaagcaaaaaccaatggaactgccacgttcgtatcgagatcctgcaatgtcattggttgacatcaaaatacctttcaattaatacgcaccgtgactgttgcgatgtaaagctgtcgataatttttcggaatttctgagaatttcccatccaaatgcaagctgtgtgcaccatacaaagattcagcttcctctgcttgccacacaactagcaaatccttattagactcaaacgttccagaactgtctaaacaacattttcctcctttaaaataggcagaatcgagggctggtggaaaactattcgtcgatttcctactcagcataccgtccagtatgcgactgatttctttctggaaaaagtatatgttttattgattccacgatttattatttacgttgctcttgagaagttcaacaacttcatatctttttgaaagtgtaacagcaagctcataaaggcgttcttttgatggtgaagaagacattgatgaaactgcgatttttctcataattaattgcacctaaaatataaatttagttttgaaaaacgtaaatttcagtatactgcaatttcgcttctcct