Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:321D5   

TH:321D5RNAiTH:321D5
PCR_productTH:321D5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST16H12.6 Source_evidenceePCR840WS150 Sequence/Annotation Release
Overlaps_Gene T16H12.6 Source_evidenceePCR840WS150 Sequence/Annotation Release
Chunk_score Abs_score735
Max_abs_score735T16H12.6
Specificity_index0.895
Rel_score1
Map_statusUnique_ePCRIII1009876910099886
F47D12.7 Chunk_score Abs_score86
Specificity_index0.105
Rel_score0.117
Overlaps_transcriptT16H12.6 Source_evidenceePCR840WS150 Sequence/Annotation Release
WB_DNA_textTH:321D51118gcaggtatccatttggcacgcggaaaagttggatctagcagtgtgcaatgatggcaccggatgccacagaccctcccgcatatcgtaaatttcagcagaatcaagccgacggttcccattgaatccaccaattatcatacaaacttgattcattattgagactgctgtgcagcccgtgcgacgtgtccgcatgtttgatgagagaggatgcctgaagaaagagaatatgttgaagtgtatctgaatgcctacaaagcggcctacacatgcctacacgcctgcctgctacaaaaagtttcaagacaggcatccacctaggcaggtaggaaaatattcacacgaactttactcaccatagatcaagaactgggtcataaacttctcctccttgatgaatattccgtccgtcaaatcctccaatgacaactatcttgttgtcaatcgtcaccacggctccgtcggatcgcatttgcgccatattagcaacctctgaccattgatctgcacggtagtcgtacatttcggcagtcttcagtcgagaaactccattcattctgtaaattgaggaattaacacagttaagtcagcacacagtaccctccacaagcgaagatcagaggccttccgtgcgaatcgttgatccttgctgacgtgacatagcacctcttatcattcatattcgccccgctcctccattctttagttgacaaatcaaagagaaccgttgtctgaaactgctgagtgccgttgaatccaccgtacacaatcagcttgtcctcaacgacttcaatgccatggtatgctcggcgaatgttcggtctggaaattgtctcgtgttatgaaatgttttctagaaggcaaacctacatatcgtagttgaagttacacgtttgccaacggtcacttctcgtattaaacacttcaatattttgagcaacaccacgacttgcccatccacctggaaatttaacaatacaatttgtatcacggcttttatcccaaccaaagcagacgattgcatccattggctgtcgagtacgaattacttcatacttcgtggcatctggctgaggctgcctggagaaatttcgttgagcaaactgggccatacgatctga