Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:321E2   

TH:321E2RNAiTH:321E2
PCR_productTH:321E2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR10E9.2 Source_evidenceePCR766WS150 Sequence/Annotation Release
Overlaps_Gene R10E9.2 Source_evidenceePCR766WS150 Sequence/Annotation Release
Chunk_score Abs_score703
Max_abs_score703R10E9.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII39624513963580
Overlaps_transcriptR10E9.2 Source_evidenceePCR766WS150 Sequence/Annotation Release
WB_DNA_textTH:321E21130aaccgaccaagcgaattataatacttttcacaaaaataaatgttcttgaaagcatcccattgttccggggttcacaacacatttttaactcaaaattagacgtaacttctcaagagcattttctcaattaaactgggcctgaagtattctcagattcaaattatatagttcaaagattcctttttttgagaagttatactcttttaagtagaaggatcttttgcaaacaagatgaaaaaacataactagcaaggaaaatacaaatatcttcatttctgtaatccatgtacgttcacttatatcaagccgttgagttctcaggcctgaatagtcgatccaccacaaggagttgcttcaagacacacattcacctgactcttcttgttcttcttacgagactgtgaacggcaactcgacgatccagcagactttgcacttttcttcgaagaacgacttgaacgacgggatgctcctctaatagatttcttctctttttgctcctcttcgccaccgcaaatgtagttggacaaccagcatccacctttgttagtgttgcgacgtttgtattcctcgacaaatcccatcagatttccaattggagcagcggtcagggcgtctgaaattttaatgttcagagtttcacaatgaaatctaaaagagtacctttctcaatgttaactgcagtgatcgtgtccagctcttcaattccaacagggtgatccatcgactcgatacacgtggcacttcctggcaagttgatgagaacctgcggagccgagtactgatccgtaaacttgactgcaagcgagaaagcctcctgatcctgagtacctgctgtagacttctgatcgataaactgcttgaggttctttgcgtaaatcggcatcacataacccttgatcgacatgttcaacttatcccaatgggaaagcttcgacgagttgacacgaaactggatgacacgatgagatgatggagggaaacggaagatgttagttgggaatgagatggcttcgcttgaggtgatcaacttgagaaggaaatcctttcccgtggtgttgctgaagacaaatgttcgttggacgagatcacgaccagatgagatgtgaacttccgatggatttttcttc