Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:321b12   

TH:321b12RNAiTH:321b12
PCR_productTH:321b12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK520.4a Source_evidenceePCR889WS150 Sequence/Annotation Release
ZK520.4c Source_evidenceePCR889WS150 Sequence/Annotation Release
ZK520.4d Source_evidenceePCR889WS150 Sequence/Annotation Release
Overlaps_Gene ZK520.4 Source_evidenceePCR889WS150 Sequence/Annotation Release
Chunk_score Abs_score847
Max_abs_score847ZK520.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1368870413689814
Overlaps_transcript (5)
WB_DNA_textTH:321b121111tgcagattccagacgtcaaggagatcggatgtgtgagtttgcgacaaaaaaattgcgccaggtttttagaaatttctttatgttttcgacgaaaaagtgggtggaaataaaatcctaggccacggagatgacttccgtggccgatgattatcagttaagaccacagtgcgctttttcaaaattttgtgttcctggaaaataactattaaataattgagaagttttgaaccaaaaaaacaaatcgaaattttcagctcgcactagaaatctggaaagaagacctcgtgaagaccattctcccgcagctcgtcaaacttctgctcatcgcgattgacaatgatcggaaaggaaacttcccgcatatcgccaatgaagtctccggcgtcattaacagcttcgttaagatggaggagacggatttcgacgttgtaccggcagaaggagcacgctataaggctcgcgagtcgacaacggcgttctatcaggagagctttgagaaaccgcttcttacggatacggaacagtactattcggcgctcgcacaaaaaatgctcaccgacctcagctgcagtgagtacatggaacaggttatagtgctcctcgaacaagaagagatgcgtgcgaagaagtatctccacgaatcgtcggtggagaaagttatcacgttgtgccagaaagttatgataaaagctcacaaggataaacttcacgcagtgtgccatgatctcattactaatgaggagaacaaggacctccgcaacatgtacagactgttgaagcccattcaagcgggactctcggtaatggttaaggagttcgaggaatatgtgaagaagaaggggctcgaggcggtgtcgaggctcaccggcgagaatgtaccccagcaatttgtggagaatgtgttacgggtgtataacaagttcaatgatatgaagactgctgtgttcatggacgatggcgagttctctagtggactcgacaaggcgttgcagggagtcgtgaactcgaaggagccaggacagtcggtgccgaaggccagtgagcggttggcgagatatacggatgggttgctcaaaaagtccacgaaaggactatcggagacggatttgga