Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:321e5   

TH:321e5RNAiTH:321e5
PCR_productTH:321e5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20G5.1 Source_evidenceePCR1104WS150 Sequence/Annotation Release
Overlaps_Gene T20G5.1 Source_evidenceePCR1104WS150 Sequence/Annotation Release
Chunk_score Abs_score1041
Max_abs_score1041T20G5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1020519010206384
Overlaps_transcriptT20G5.1 Source_evidenceePCR1104WS150 Sequence/Annotation Release
WB_DNA_textTH:321e51195cagccaccattcaaaagttccagcagtgcccgtctactggtccaggaccatctccacttcttcaatatttcggaattcttctcgatcaaggaaagttgaataaatacgaaacactcgagctgtgtcgtccggtcttggcacaaggaagaaaggagttgataacgaagtggctcaatgatcagaagttggagtgttgtgaagaattgggagatctcattaagccgcacgatgtgaatactgctctttcagtctatttgcgtggaaatgtcccgcacaaggttgttcaatcttttgctgaaactggacaattcgacaagatcgtaatgtatgccaagcgtgtcggattccaaccagactatttgttccaacttcgtcaaattctccgtaattcgaatcctgatcatggagcaaaattcgctcaacttcttgtctctgagagcgaaaacggagaaccacttgctgatctttcacaggtaacgaatgagaataaggatttggctaatttaaaccttttcagatcattgactgtttcatggaggttcaagctgttcaaccatgcacttcattccttctcgaagttttgaagggtgataagccggaggaaggacatctgcaaacgagacttcttgaaatgaatctgctcgctgccccagctgttgccgatgctattctagccaacaagatgttctctcactacgatcgtgccgctatcggacaactctgcgaaaaggctggacttcttcaaagagctctcgaacacttcactgacctctacgacattaagcgaactgttgttcacacccatcttctcaagcctgatgtgagtttctaattagatttctaaaataaatgctaatttattttcagtggctcgttggatatttcggaagcctttctgttgaagattcggtcgaatgcttgaaagccatgctcactcagaatatccgacagaacctccaagtcgttgtgcagattgcatccaagtatcatgaacagctcggagctgacaagctgattgagatgttcgaaaatcacaagtcatacgaaggtcttttctacttccttggttcgattgtcaacttcagccaggacccagaagttcacttcaagtacattcaagctgccacgcgcacagggcaaattaaagaggttgagcgtatctgtagagagtcgcaatgttatgatgccgaacgtg