Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:322A5   

TH:322A5RNAiTH:322A5
PCR_productTH:322A5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F43D9.4 Source_evidenceePCR604WS150 Sequence/Annotation Release
Chunk_score Abs_score561
Max_abs_score561F43D9.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1050591410506652
Overlaps_transcript F43D9.4.1 Source_evidenceePCR604WS150 Sequence/Annotation Release
F43D9.4.2 Source_evidenceePCR588WS150 Sequence/Annotation Release
WB_DNA_textTH:322A5739ggcatttccagaaagatggaagaactttcgaaaccgaagactcccccctgtacccaaaacaaaagaaaaacactttttttctcattttacagctttatttttgtcctggcagtatgtaatctagaaagttgggggcaatttagtgctttccggtggtggtggtgctggatggcttctgggtgacagcgtgtccagcagaagtgtggattggaagagcacgaacggtggtgttggagccggtctttggagcatcgatggtcatctgtccttccttgttgatgacggtgtggatgtgagccaagtcgacgtcctttggaagagtgaactggcgagtgaacgatctgaaaatttttaattaattttaattccaataaatgaaaaataaaataaaaccaacctcttgctgaacccgtgctcggtcttgacctcgtggtgtccctcaatggtgagaacgtgtccctcaagattgaccttcaactcttccggcttgaacgcggcgacgtcgagcttgacacagaacttctgggcggtgttctcgacctcgttgagctgttgtggcacgatgttgttgaagttgttgagcatgctgtgacgctgagcccagtatggcatcatgtcctcgaagtcgcggaagagtccggttggacggccagtgtatgggcagagagaagacatagttgagtgaatagggttaagaatgaggtgaaaaacgatgaacgtctgaggaaaatggcaaaat