Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:322B6   

TH:322B6RNAiTH:322B6
PCR_productTH:322B6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C07A9.2 Source_evidenceePCR495WS150 Sequence/Annotation Release
Chunk_score Abs_score432
Max_abs_score432C07A9.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII96946589695495
Overlaps_transcript C07A9.2.2 Source_evidenceePCR450WS150 Sequence/Annotation Release
C07A9.2.1 Source_evidenceePCR495WS150 Sequence/Annotation Release
WB_DNA_textTH:322B6838gggattcacaaaaccttgatatgagagtatataaaaatagagatcatccagagcaaccatgacatccacaatgaacgcattcgataacacgctccgcatcaagtttgctttttggaactcgacagatgcacgcagtgccgaaattactgtctcgagtattcacacatttaacgcaacacaggttctcgtatccttgcttcttccatttcgcgataagtgctgcgtcagcgaacttggcggttaagcagaattcgtacaattcacgggaaatttcagctttcttgtagtacatgtcatagacgtatcgtgatcgttggtgatgaattctgaagaaaaaggtacaaatttaaatcaattaatggttattaatacctgaaaatcggccagttaatttcagtttttcgctttccttcgtgtggttctgtttcggcttcacgcattttcgcctgaaatatatatttttgaaaaagttgtccgaagttaaaagaagactcacttcgaactgttctagtgtgggctcgatcaaatcccatccctctggtggagactttcgaactcttcgtagtttagtggccagtgacattttgagctgaaaatgaaaatctaatgagaaatgaacaaaacgaaaggaaacaatgggaaggaattgaataattatgtgaacaaatatatacggaaagtattaagttcgataggaatctaaaattgattcttttgccctttaaaatcgagagaaattaacctgaaaacacaaaaaaaagcctcaaaaataaacatatttttcgaaatgaaatttggtacgcaaacaccacaccggacgagcattgtgcgtcaaatg