Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:322D9   

TH:322D9RNAiTH:322D9
PCR_productTH:322D9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC48B4.2 Source_evidenceePCR579WS150 Sequence/Annotation Release
Overlaps_Gene C48B4.2 Source_evidenceePCR579WS150 Sequence/Annotation Release
Chunk_score Abs_score537
Max_abs_score537C48B4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII95933499594994
Overlaps_transcriptC48B4.2 Source_evidenceePCR579WS150 Sequence/Annotation Release
WB_DNA_textTH:322D91646aatttggaagttggctgggcatggcttaaatgaattcaaattttgccttacaaaggtaccttctattgttaagcacctaacaaatgtttactctaagaagcttaaagaattgatacttcctattattccgtctcttcttctgccttatctatgaatcactccaaaagttgcaaacaaaaattcttataattctcaaatcgaaactttttgcgaaatacgtgagttctagaactaattccccatagtgtagtaccccggaattcggaacaagctttgttccgttttctgcgtttttcggatttatcatttccttttcgagtatgacattgatttatctattcagttttgtgagaacattttgttatcaaagttttctattttcaaaagatgaactatgcatcatactcaccatcactttactttgaaaggttatatctctgttcatttcgaagttatcaataaataatcaactacaaatcgatagaaaaagaaataataaatatgttgtcagttgacagtttttgtataaaacaaacgacaactgagatatgagctgtcaaagttgaacaattaaatgcaacactaattattgtaattctaactttaaatttacgatattggatattaagtatttattttatttccgcgtattttagtttcatacagttaaaaaaagtttacttcaaaaactcactacatcgtttaatgaaatttgaaatttagaaacaaagtttcaaaccataaactttcaagtttaaatcacatgtagttcttactttatcaattctgggagcaaagaatcgttgataaactgccaaaacgtagtcaagtgccgcaaaaacaataagaattggcaatcgacatgttgcattctccatctctttaaaatttgttgcaattgttgtaatgtgtgatgcaatgagagaaaacgagcccgctgctcctccacaaaggaatacagttggatcaagagccagggatagaattgaacctaaaatagacattattcgaaatggtaggcagttccatttttcattaaaaagtttcacaaaacaataatgtcttgaacttttaatttttggcaatttcaatagttttttgtatttgacccaatattgataataggcaaactgtccttttttattttatgccttcatttaaaaaaaacctggaaaacctaccaaaaagtacacccataaaatacaaaatataaattctccatcgatgaaccaactctaatggaactccaattgccaactgaatgagaatgttgaaaatgatgtgaaaaattctgtaatttttctgtgaactttactacatttttgacgataattctacagcttcttaatggtctttgtcagaaatttaaaaacttttaaaaactagacttacccaacattgattagacaataagtgaaaagtctccaaagctctggtaaatgatattgagaaacaataagtggagacatcgtaggaattggaccagaaagccaaacaccttcagatgaatcgacaacgtaatagagatagaaagcgagttgaacgatagagagaaatattagaaaaataggtggtggaacacatttatagcgttgaagttcactgaatacgtgaattctttgattctttggggttactgtcagagc