Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:322H6   

TH:322H6RNAiTH:322H6
PCR_productTH:322H6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC24H11.1 Source_evidenceePCR969WS150 Sequence/Annotation Release
Overlaps_Gene C24H11.1 Source_evidenceePCR969WS150 Sequence/Annotation Release
Chunk_score Abs_score843
Specificity_index0.488
Rel_score0.953
Map_statusUnique_ePCRIII1178807811789735
C24H11.2 Chunk_score Abs_score885
Max_abs_score885C24H11.2
Specificity_index0.512
Rel_score1
Overlaps_transcriptC24H11.1 Source_evidenceePCR969WS150 Sequence/Annotation Release
WB_DNA_textTH:322H61658ccatgcctacctacgttcctaatgtctttttttcaggaaaaagagatccatgtgctgttgacacgtgtcttcaagtactacacatctccaccgaacaagaaaactgcaccatctgcttcagcatctgcaaccacatctatgagccctccaaaaccggctgcaaatgctcttttggaacttcaagctccgatcaacatttgtggagatacccacgggcagtacaacgacttgcttcgtattttcaatgtaagtccttacctgcctgcctaccataccaactgcatgtgtgctaagctgttctatatgttccctttcaggcctgcggagcagcgacaaaaactcaatacctcttcctcggggactacgtggatcgtggaggtcactcattggaagtcattatgcttctcttctcactcaaattggcaatgcccagaaagatgcatttgttgagaggaaatcatgagttgaaggccatcaacaagtaagcacatgttagtagatctgacacaaaataatcttattggtaacagaaactacggcttccacgcggagctcaagaagcgtttccaaagggaagaagtgtatgaatcggtttacaatcacttcaatcaagtcttctcgtatatgcccctgtgtgcaatcgtctcgaagcgtattctctgcatgcacggagggatttctccacatttgaagtctctcgatgatattcgtgcaatcccattgccactggaaactgcaaagactcatgtgagtttccgtcaaaatgcccgacttgatcggaatatcgatagtctgcgcttcttttcatcttaataccatttcagcctctcgcttgtgacttgctgtgggcagaccctgaaaaggatgccaaaggctttgagcccaacaagatccgtgcaatctcgaacgtctttggaaagaaggaggttgatgatttgtgcaagagattggatatcgatttgattgtcagagctcatcaggttggtctttttactagttctatttgtgctctattaactataaatattctccaggtggtcgagtacgggtatgcattcttcgctgatcgtcgcctcatcactgtcttctcggcatctcgttatcaaattgagctctgcaattatgcagctgttgtggtggtcaacaagatgctcgaacttagctttgttcagctcaaacccgaagatttcgaagttcgacgtgatgagtgcgaggagaatgccaaggatcagacgacttcaaatgttcctcattgagtttttggctgtctgaatttgaataaagtgtttttgggggaattggggtttgtacagtcaatttgttaactagaatagaacatttacagtaatttgaagtaacaattagtttacgatttttcaaaaaattgtgcaaatatctcaggtagggctgtacaaatcggattccggtcgtccgattttgactccgccggacgcacatgcgtccggtttaaggtaggtttccacggcggccgacagtttccgagtttcgccaccttctatactaatcatagaattctgtagtgagtggcgaaactcggaaactgtcgaccgccgtggaaacctacccccaaccggaacaaatcgcttgccgcccctttgccatattcacttcagaatggctgcaatctcatgtcccaa