Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:322H9   

TH:322H9RNAiTH:322H9
PCR_productTH:322H9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE03A3.8 Source_evidenceePCR231WS150 Sequence/Annotation Release
Overlaps_Gene E03A3.8 Source_evidenceePCR231WS150 Sequence/Annotation Release
Chunk_score Abs_score189
Max_abs_score189E03A3.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII40771254078055
Overlaps_transcriptE03A3.8 Source_evidenceePCR231WS150 Sequence/Annotation Release
WB_DNA_textTH:322H9931taaagttggcacccagacgtgcctgcctatcagggcggactcaatctttttaccatagccgtttaaaggaacatcactccgctcactcacgctctaaaacttgaacttttgcagaactccgaagtttttttaaatgtgataatatcaagcatgaatttcatttctctgtcaattttttcagaacatttaaaatcactttttccgtttttcactcctaatccttttttgaatggttttttaaaaattattttttgaaatgactttcttctaactcacactcaccttttcccaataatttgtgaatgtctatcgttgtttgggtgtgattcttctacttctagctctttctctatcttttcaatttgcaattttttcatttttaaagtcggcggaaaattgagttcgaaggtgattcttttgaatttgccaggcaaatacaccttgtctcaccttcccttgaatttccaccgacattccccacgccttctaacactttctcccttttcaataatttcagcaaatgtggctgtaaacgacgacgtctcctcgccgaactcctctgtcactgccaactacgggcatggtacgcgtgcatgttatacccatcgaatgggcagatttttatcccccaaaaaagctttctttcgcttctcattgattaattgatttgagagtaaacttctatgcatgcagaattttcatttttcgatttttcattgattaattttttttgttgaaaatattttgttttagttctctctttttagttctttaagtttgcccagaatacatcttgcaaaagatttatctttcgcaatttatattcgaaaaggaataggttatgtttaaaatacctttgttcttgcttcaaaaattgtggatcttattgattttgagaccaaggtgcagacgcggtggtggttaaaagcac