Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:323A8   

TH:323A8RNAiTH:323A8
PCR_productTH:323A8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY41C4A.11 Source_evidenceePCR763WS150 Sequence/Annotation Release
Overlaps_Gene Y41C4A.11 Source_evidenceePCR763WS150 Sequence/Annotation Release
Chunk_score Abs_score679
Max_abs_score679Y41C4A.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1172167711723346
Overlaps_transcriptY41C4A.11 Source_evidenceePCR763WS150 Sequence/Annotation Release
WB_DNA_textTH:323A81670aagccatggattttgactgctttgcacactggaaatgttcaaatctggaattatgacactaaaacgttggtcaaggctatggaggtgagttaaaacgattctgatttttcagtaaaggagggggtgtactctagctctacttacataggggtgcttatctcagcggagagaaaatttttcagaaaaatatctactagcaagttatagaaaattttaatttcccacattttccaaattgatcacttttctatttcaactctccagccccgataaactggtttttactaattttttgaaacttttgtattttttggttcttttttttcggtcgttttttatggaatttatgatcgacttcggaatgcccaatttttcctgacttttgacttttttgacttttttttggatttttcggaatatctgggtatttctcttttccctcccccagccccgcctaagcctaagactaagcctatacgtaagcctaaacctaagcctaagcctaagcctgagcctaagcctaagcataaccataacccgaagcataagcctaagcctaagcctaggcataagcctaatcctacccgaagcgtaagcctaagtctaagcctacgcctcagcctaagcctaaactagaacattcacattacatttgccaagtttttcaccgtttcaaaattcataaattatatttccaggtctccgaaaaatccacgcgtgccgccaaattcatccatcgtaaaaactggatcgccaccgcttccgatgatcagcaaatccggatcttcgacgctgaaacgttcagcctaatcaacgagttcacagctcactctgactttattcgctccctaaccgtgcacccgacacttccctacctcatatcggcttccgacgatcgtaagatccgagtttgggattgggaaaacgagtggagaatggagcaggaattccaggagcatgctcattatatcatgcaaattgccgtgaaccctgaagacccggagatgtttgtcagtggatcgttggataaaactttgaaagtctggaagctcggtgagcaagagtcgatttgcactctggagggtcatgagaagggggtgaattgtgtggagtttctgaccggtgggagaattgtttcgggctccgatgattgctcaatttgtgtttgggatattcaggtgagcgggaatttgaagttttataaacatggtgcatcgagcggaaacaccacgcttaactttaggagctcgtatatcgctggtattttattctatcaaaatgttgctaattgacaaaatattctttgtttgtttctctataattttgtaattgacaactatttgataaagtccaaaccaaccaagataaaagtggtcaaagtttaaaaaaagacatggtgcatcggaacatttttcagacccaaaaatgcattgaaactctaaaaaatgctcacaaaaacaacgttacctttgtcaccccattcaagacatggattatctccggagccgaggattctactgtaaaaatttggaattcgcagactttctcgtgggtttctttagctcaacttcaataaaataaattcaaaacctaaaacttcagattggaaaaggagttgaattttgagaagggaagagcttggtgtgtggctgctggaaaatccgatgcaa