Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:323C6   

TH:323C6RNAiTH:323C6
PCR_productTH:323C6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05B2.5 Source_evidenceePCR915WS150 Sequence/Annotation Release
Overlaps_Gene W05B2.5 Source_evidenceePCR1010WS150 Sequence/Annotation Release
Chunk_score Abs_score947
Max_abs_score947W05B2.5
Specificity_index0.255
Rel_score1
Map_statusUnique_ePCRIII1098397110985483
T28C6.4 Chunk_score Abs_score124
Specificity_index0.033
K02D7.3 Chunk_score Abs_score174
Specificity_index0.047
Rel_score0.184
W05B2.6 Chunk_score Abs_score631
Specificity_index0.17
Rel_score0.666
T28C6.6 Chunk_score Abs_score124
Specificity_index0.033
Rel_score0.131
F52B11.4 Chunk_score Abs_score70
Specificity_index0.019
Rel_score0.074
F57B1.4 Chunk_score Abs_score145
Specificity_index0.039
Rel_score0.153
F23H12.4 Chunk_score Abs_score477
Specificity_index0.129
Rel_score0.504
W05B2.1 Chunk_score Abs_score667
Specificity_index0.18
Rel_score0.704
C29F4.1 Chunk_score Abs_score137
Specificity_index0.037
Rel_score0.145
F41F3.4 Chunk_score Abs_score211
Specificity_index0.057
Rel_score0.223
Overlaps_transcriptW05B2.5 Source_evidenceePCR1010WS150 Sequence/Annotation Release
WB_DNA_textTH:323C61513gcttgtcattggcatcagtactttccgtctaaaaccagattacatttgaagcttattcattaataactttaagaattcctttacaccaataaattgagagagaacgcgatttttagctgtgatatagtattttgattggtttttgtagtttcccgatttatacaataaaatcatggtaaatttttgccagatgaggtttcaaagcaattacaaaacaatttcagagattcagggtgtcactaccttgtgacacatacaaccagcattaatcccgatagaatataagtcgtttattgggattataagttgtgttcttacaatttttactttgatataattaaataactgacgtattgcttcgtgttgtattaattatgcttaaatagatttccagtttcaaaaaccacaagtaataagacctgtcaaataaattctttaaagaaattgaaaaattgaaatgaaatgtttttattcgattaaaaatgactagacggtaaagaactaaatcttcctgagtgtttactttctgcgggttccgtcctcgaagaatactcctccgtcgatggcgcagtactttggacagattcccttctctccggcacctccagattgtcctggctgtcctggggctcctgggtttccgtcggctcctggctgtcctggggctcctgatggtccctttggtcctggggctccggcttgtcctggtcctcctggggctcctggggatccagctggtcctggtggtccttgtggtccggcttgtcctggggctcctggagaagactcggattgagcgtcggatcctggttgtcctggggctccagcttgtcctgggtttcctggggctcctggggctccctttggtccggctggtcctggggctccggctcctgatccttgcccggcttgtcctggtgctccggcatctccttgtggtcctggggctcctggggctccagctggtccttgtgggcatggcttgcatggtggtggggtgattggctcacatggttgtgctggtgggcgtcctgggtttcctggaagtccagctgctcctggacgtcctggtcttcctggctttcctggggttccggctggtccagcggctcctggaaggcagcatccagagcatgatcctccttgggatccggtgtttccggtctcaacagcctcatcggttccgtatccagcttgacgggcgaaacgggaagcgttctttggagatccacggatgtggttcacctcagcgaaaatgtcacgagcagagtgcttgcagaacttgatctcatggttgatctgggtcttgattccatcaacatagttgtacaccaatggaagggtgatgcacagctaaaatattccatattcaattaactaaaatgtagagtgcaaagaattcaaacttaccgagaaaacggcgacaaccgagaaggtaacagccgagtaggcgacaaagcggtaagcctgaagacgttgttgctcctccattgcaataaagatgggcaagtgc