Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:323E10   

TH:323E10RNAiTH:323E10
PCR_productTH:323E10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC47.13 Source_evidenceePCR936WS150 Sequence/Annotation Release
Overlaps_Gene ZC47.13 Source_evidenceePCR936WS150 Sequence/Annotation Release
Chunk_score Abs_score852
Max_abs_score852ZC47.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII12871791288852
Overlaps_transcriptZC47.13 Source_evidenceePCR936WS150 Sequence/Annotation Release
WB_DNA_textTH:323E101674ctgctcctgggtttcattcattttcaaacaaaaatattaaaaaatacaatagctcagaacaaacaaatgttttcaggttttttgcgtaaaatcaaagtgaaagggatgttttacaatcttttcacattcaattcaaaatactttacaagccactcccattcaagagaaatatcgaatttgtcggtgccatttgaatattcaatcttaaagtccttaccgccggcatagtccggtttgaagactttagcaatttcaatcggatttgcgtttggtcttaaaaaacgtatcacgcaccattgaaatgtacttcttctcaaaagatcctgcaaaaaaagataatgaaatgaaaaataaggttattttacgtctcgaatttgtatcgcggtttgtattgctttaaatttgtccaatgtgtaaatatagaagcttttgaaatgaaagaaatgagcaatctttgcaccgaaaatactatagcgaattgtgcatatttctgcatttttccattgctccaagcaggatattcgttcgaattggtcaattgcaatcgatttcaaatcaatcgctttaagctctttagaatcaaataatggaagaatcgtaagcacttcatccaatgagaacttatcaagttctattctctttacgtgaatacatttttctgatttaaaaaactcaacgaaagttgtaacagtgtcgcgtatattttttgtacagttcataattctagctcgacttgcgtgcttcaatactatcttcaaatccttgaccgcactgtccataaagttttcttcatcagtttcctttttctgttcattgtaattgacatttgaatgaccatttgctgaatcagtatagttgattctaattctgtccaaatacatattgatatcatggtcatccagctggaagtctacatcgttaatacgaatcgttgcaaatgtatcaacggcagttctcaaactgcgacacactctacttcaaaaatacaatacaaaaagtattgaaaatcgttgttgcctaggagttttagtccccggttactcctaattttgtgagtttaaattgttagggttcttcctcgacgaaaagaaggggaatttcaatgcatatttttccggttttcttgtgcaccaaataaaagtttgagcaggaatactacattttgacacaatttcctcattgaccacactcattgtttcaagaaaaaaagataataactcacagatcctcgagctccaacttttccaaaacaagttgagcgacatctagaggcatattgagaaaagttggcgatttcccataattttgatgtgtctttgaaccaatttcgatcattttggagacttcctgaaaaactaaatatttggtcaggcaggtttgaagattggaaaatgggattgggaaaatgagaacgttcaagctaacgaggaaagtattaacaatgggatgaaaacaaattctgggaatatgaaaaaattaaagtgaaaaagtgaaaactataacaaacggtttggatcggctggggctctacattcatttaatggtagaataggaaaaatacaatggacactgaattaccacggaatcaaagatgtgaatagcagaagatgagaacgttggtagttcttttatagtagagatttagagaaagaaagacgcaatcctttgcaaaaa