Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:323E7   

TH:323E7RNAiTH:323E7
PCR_productTH:323E7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39A1A.22 Source_evidenceePCR1405WS150 Sequence/Annotation Release
Overlaps_Gene Y39A1A.22 Source_evidenceePCR1405WS150 Sequence/Annotation Release
Chunk_score Abs_score1384
Max_abs_score1384Y39A1A.22
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1070349510705090
Overlaps_transcriptY39A1A.22 Source_evidenceePCR1405WS150 Sequence/Annotation Release
WB_DNA_textTH:323E71596aggcagacatttttgctcacatagaggctctagaggtcaatgtgacctatttaaaagaggcttaggggcagaaaatagggaaatttccgaagtaacacgagaaaacatctacgaaaactagatctatgatttcagtatagtttccgtgtagcctcgaaaactcctgatattttgcccgctaaacctcccgattaggtgttagtagtgtcgatgaaagtagtagtgacgaccggagcagcggcaatcatccgattgaaccgattcttacgaagaagctgtcttgaggccttcgccgacttcttctgcttcttgacacgctccatgagatcctgtccgcgatgcgtgaccccatccatttgatccattttcgatagcagtgactccaaatctccttttcgaatcggcttcaccgagatatcacgcaccgcgcggaattgaccacaattgttgacatgctcattttcaagtcggaaatagttccagataaaccgacggaacacttcgaatggtgcggttactgtcgtcaaaaagtccgagtcaagagtccaagcttctccgagcgagacgttgagcacccaagccaatcggagcacaaaatcctgagcgatagccatatagtaataccatttactaccatagatcatttcttcacgcaagaatcttgcctcctttggagcccttggatcgattaatccccaatccatgaagatatcccaaaggaaggtgtaggtaaaggacattatataggacagaatccaaatgtagaaaaagatcgaagtggtgttaggatccgtagcctcgtagtacttgttcagggctccacaggcaactacaaagaaggtcgtggaatactttccagcattcactaaatgtggatgtactcgttttgtatctctataacgtctgaggcactgcagaaaacggatcattgccggaattatcgacatgagggaccgaagacctgcggcagaagcacattgatcctttccattcgacaactcgacacttccccagggaaccgatccagtggtagagttgattcccttcacttcaatccacccattcgagtagtcaacttctgtagcgtaaaagcacacaaagtactgaaagtctaggaatgcggtggtcagtgagttcatttgatctccaagccagaaatcggtgaatgtgacgaaatggaatggtgatgtgaagcacttgtagcaatgtttcagaagccagaatcgagaatttctgtggaataccgagtcgggtttggcgattggattcagaagaagaatcagacaaaccaccattagtgctaatggaggtgcgaatggtggaatatggagcatatgagcatatagataggcgagaactgcaaaagaccacagcataatcataaaggatgcgatttgcatcagagtttgatatgagagatgattcctgggatctacttcaaagatcagaacgtgattgactccagcagcagcccaaccagccatattcacaccacaaaggaagattgataggaagagaagtagtggtcctcggaataaacgaacggctacccattttggttcttgaggtcgtgctggggaggcgatccatgttaga