Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:323G11   

TH:323G11RNAiTH:323G11
PCR_productTH:323G11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC482.5 Source_evidenceePCR731WS150 Sequence/Annotation Release
Overlaps_Gene ZC482.5 Source_evidenceePCR745WS150 Sequence/Annotation Release
Chunk_score Abs_score640
Max_abs_score640ZC482.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1279154812793206
Overlaps_transcriptZC482.5 Source_evidenceePCR745WS150 Sequence/Annotation Release
WB_DNA_textTH:323G111659ttttggcaacgtcttcgacaatgcaaaaaattacaactcttgaaaattagcagaaaatcaataataggctccgcccatattttggcataaaagccaataatttccaaaaaattccagacatctctgttctcaatgtatacttcaaactacaacgtcaacaaggctactatatccttcaaatctatacgccgtgcacattggtagttgtcatgtcatgggtatcattctggattaataaggaagcatcgccagctagggtctcattgggaattatgactgtgctgtcaatgtccacaattggatttggtctgcggacggatttgccgaaagtttcacattctacagcactggatgtctatattttgtgagtgaaatattttttaggcaagttgccatggaataggcattgggtaggtacttgcctacctcgtgcctactaaaggcatgtaggcacgcaaggagcctgaaatatttattaggtaagaacgtaggcaggcataagatgggcattttggtcagactctaattacctacttgcctacaaattaaagtcacataggcatgtacatgggtatgataatagaatgcaataggtatgaggtgggcacgtaggtaggcatgggataggcattatgatgcccacttcaacttacctacgtgcctacatcatgcctacctgcctacatttcagaacctgtttcgtctttcttttcgctgcaatggtggaatatgcagtgataaattatgcgcaaattgtatatattcggaaacaaattcacgacttaaaaggtctcgagcagaataccgcggtgggtttctggttctttttatctaaaacaaatatttaaaattttcagatgggccaaatgttcacagcaggtctgatgggagcccgccgccgtgacacgattcaggtggacgatctgactgtggagaaggaagaagctcggcttaaagcagttccatggtggaagaaactgtgttttaaggatgaacagggaaatacttcaagtgagtggcagttggaaaaaaaaattaattttgaaaaaaattctccagtgttctaccgtatggctgtgaaagcagcaattgccaagaaaactttgaggaatggagatccggctgaggtattgattcatttttggattaggcttaggcttaggctcaggctcgggctttggcataggcttatgcttatgcttaggcttaggtctaggcttaggcttaggccatggctcaggtcactgctttggcttaggcttaggttcaagcttaggataaggcaaaatctttcaggtcgtcaacaaaatcgataatttctcgaaactggcatttccgacgctgtacatcatattcaatgtattttactgggttgcatatctacatctgatccccgatgaaatcgatagtctgccgaatattgctggtggattgtattgatttttttaaacattgaagtaataataataataataatagtgataataaacttgtgagaaaaatttttaatttaaaaaaaaaacatcaacttctagcttctagcgttcataattttttggaatgaacttgcgcgacacctcacgaacttctgaatttgcgggttcgcgaaactcaatgaagtctctttttatcgacttttttaaaaacatgcccgacaca