Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:324F3   

TH:324F3RNAiTH:324F3
PCR_productTH:324F3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39A1A.18 Source_evidenceePCR420WS150 Sequence/Annotation Release
Overlaps_Gene Y39A1A.18 Source_evidenceePCR420WS150 Sequence/Annotation Release
Chunk_score Abs_score357
Max_abs_score357Y39A1A.18
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1069158610692792
Overlaps_transcriptY39A1A.18 Source_evidenceePCR420WS150 Sequence/Annotation Release
WB_DNA_textTH:324F31207gatcgatgtttcccacaaagatgatgccccatgatgatgatgtatcaagatttttgttttattaagacccattaacaacaattttaaacaatgcacgcatacggtcgttcctttgaatatcgactcctctttatgatcgaatcactgtcccatttgccacttctagtttaaaaaacatgctttttcgaatgccattaaatctgaaactctacgagaatttcttattttcgatatttagtacgtatgttgcttcgtgaattttcttaattagtgcaaaaatattacccattttatagaggtttttattcaaatacaattttcagtgggtaacttcgtactgaaaatcaaaaattaaaaaaaaaatctcgtagagtttcagatttagtggcaatgggaaaatcatgttttaaaaagtagattcgtgaatttccttaattagagctacaatattacatatttgatagaggtttttatctaaatacaatttttaatgagcaactaattggtaatatttattgaacacaagtgcgcggggtagcctccaaatccgaatcatcagagaatggggttgatggctgatcgtaaagagttgagacagattgaaatggtgaagtattcgagtatgacagatcagaaaaatcgtcttccgtaccaaacttcaacgacgtgttttcaatgctgtacaactcggaaacctgaaaaattgcatgttcaaggcagttgtcggctgctggaattatgtattcgcatatttttgaaactaccgtaactaatgttcaggcgcggtttcaggccgacctgtcgcctttttctgcattttgatgagatatttttttaaatttcaataaattttatgaaaatctatgtgttttagcagaaggcgaggcattgaataaaacctcaccggtgtcaatttttcaactctcggaacagtcaaatcgttgaactcgcttccgtgctcgagacgggacatcggatctgttttagccttggaagatgaagactctggagatgcgattggaaacatttcctgaaattgtcaattagtgcgcacttgaatagcctcagcttaccaggttgtcggcaattaacttgagaatttcacgtgatttggcacggctttccggagtccttttattggggtaagtggtctcaagatgctttcgtttttcttcaaaagtcatttcttttgccggaactttgatct