Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:324G3   

TH:324G3RNAiTH:324G3
PCR_productTH:324G3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39A1A.8 Source_evidenceePCR537WS150 Sequence/Annotation Release
Overlaps_Gene Y39A1A.23 Source_evidenceePCR160WS150 Sequence/Annotation Release
Chunk_score Abs_score139
Specificity_index0.258
Rel_score0.348
Map_statusBottom50_percentile_ePCRIII1062610010627759
Y39A1A.8 Source_evidenceePCR537WS150 Sequence/Annotation Release
Chunk_score Abs_score399
Max_abs_score399Y39A1A.8
Specificity_index0.742
Rel_score1
Map_statusBest_ePCRIII1062610010627759
Overlaps_transcript Y39A1A.23.1 Source_evidenceePCR160WS150 Sequence/Annotation Release
Y39A1A.8 Source_evidenceePCR537WS150 Sequence/Annotation Release
Y39A1A.23.2 Source_evidenceePCR11WS150 Sequence/Annotation Release
WB_DNA_textTH:324G31660gaatcgagatgaccgttgcgatgacgtttggcacctgcaaggataacgggtttttgttggaaatgataatttgtttgtttttgaaagttcaattatttttaaagctcgtgtgtaataatttttttagttcatgaaaaaaatgtttttaaacacttttaaaatgaaaacgatacatcatttttcgacttcgacagggttctctgaaattcaaaaaaagtgtaaaattagccattttagcataaattttacattttccaaaaaaacacatttttcgaaaactacagttttgtatttttcgacaaaaaaaaaagaataacccaattaccaatatcacaatatcgtcaacgatatatccataaaacatccattgaagacacacgacgaaacacgcgacacataacggcaacggaagagattcactggatttgttacggaccacctgaaaaaagtttggaatgaaaatttcaagtgtctaatttgggtttgatcttcgagaattgcgggaatttggcttaaaccaacaattcccgcatttattgtagatcaaagcgtgatggaacagcctggcaccacgtacgcaaaagaataccgtattacctctatcagtgtcccaaaaaaaatcaattacctttccaatatcgaataacggcgccgccacactgcaaatattcagaaaaatgcaataattgccgacatatgtcgtttttgtgagatgactatttgttgaatgagccacccaatagacgacgattccgatgattccaagttcaatactgatcactttattcaggaaacgctgaaaatgatgtttataattcagatttgcttgcaaaagtggcggcttttcgaaatgtttattcgaaaaacgggagaaaaaattcaattttcgattttttctaatatttctaatttttcatttttttcaaattaaactttctcccaaaaatcaaaattaccagagaatgcgtattgggcaacatatttgacgcgcaaaatatttcgcagcgaaaactacagtaattttttaaaatgactactgtagcgcttgtgtcgatttacgagctcaactttcgaaaccaataactaaaataattgatttatcgatagaatattaaaattaggcaacaaaaaaataaatattgctgtcactataagaaattcatttcaaacaatcgagcccgtaaatcgacacaaacactacagtattcatttaaagaattactgtagttttcgctacgagatatttattttgcgcgtcaaatatagtgtgcaatacgcatactcaggttttagtgttcccgtaataattctaacttacccgatttcttgtcatgtagtaaaagtacataagataacacgcctgaagaaaacagccgattccgttgcaataagtgatgacgtcatcatcttttagaagaccgtattgaatgaataatccacatgacaagaatgctgaaattttggaaattcgaaatttcagcttttttgtgggaaatggaacaacttacacaaaagaaatggggcggggcttgttccttccgacgagccacgtgtcttgatgcgatggcaaatttggaggccgcacaggaagaaagctggaagagtttttcctgatttaagttgtttcgccgtcaaaaaatcctaaattacgcgcaatggg