Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:324G6   

TH:324G6RNAiTH:324G6
PCR_productTH:324G6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34C12.6 Source_evidenceePCR829WS150 Sequence/Annotation Release
Overlaps_Gene C34C12.6 Source_evidenceePCR834WS150 Sequence/Annotation Release
Chunk_score Abs_score729
Max_abs_score729C34C12.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII34821983483890
Overlaps_transcriptC34C12.6 Source_evidenceePCR834WS150 Sequence/Annotation Release
WB_DNA_textTH:324G61693gaaccggtttcatttccttttttattccccccctgttcctgttccattcagaatatttgtcgtgatttttgtcttaaaatttagaaaattggaaattaatttgcccatcaaacatggtgcatttagttgtggactcaatgcattatattttatgagaaaatgtgatagtgttaagaacctccccccccccaaatttttttaaattttcctctttatgttaaaattattctaatttttctatttaaaacttttttctctggcttctttctgctctacaaactccaagtaaaatatggtgcattgagttgcggacccgatgcaccatatcttacgcgcaaattttaattttttttccaaccttttttcaattttttcagcaaaaatgggcgcaaaaaccgaattccgatcatccgaaccaatcaccgactcggagcgttctcaaatcaattcagtgagagcaatgcttcaggaaaagcttccagatggaattccagatgatgtaaatactgacctaaacctatgtcgttggatacgtggatatcatggggatacagagaagcttgtcaagaactttgccacgtacttggcgtccaggaaggccgccggtttcgttggcaatgattttgcggaaaagtttttcgagctaccaagtattgctccatttctacaatttattgcgtcatcaaggcttcaggatagacaatggtctgatgagcataatgcattcttgtttgtggaaagagcatggtcacagcctaaggaggtaggcgtgcctgctttgtacctactgcctaacgcccgcgaacgcctctaaaaattgacatattgatttttcagttcataaaaacgttcaaaacaagtgattacctacttcattgcttcggatactctgaaatgctccagcagctcattttaagacgggaaaagaagcagtcagctgataagggacccgttcaatttattgttattttcgatctcaacactgttaatattacggattatgtgggttttttgttctaaaaaattcacaaaatatcagttatggcctccaaaaatcgaggaaaatttaattttgagttttgtgacgtcacacttatttttattgaaaattttttagattctagagttgtctgaaacgtgttggaaacttctgaaagctcgttaaaatgttagaaaattctaaaacctaaaatctcctggaaacctttcttttgaagatttcaaaaactgcttgagttttttggaaacttctggaaacttggaaaaaatgaaatttaatctagaaactttcaggtgaacccaatgtcgggctacatgaagctctggcaaattcgaagcgagctttggcaagattggttagttaacattatgaacgggctaaaaatataaaaaataccagttcaggttcccagaaatggtccaacgaatctatttgaccaatccaccacggttactcgggcttctgtggaaagttgctcgggttttcttgtcggaggaaaatttgaagaggattgagattatttccgataaatccgacttggcgggaagttcttgccgccctggttggtgccaaaggaatatggaggtaggccaaaataagcctgagcctaagcctacacccgttttccaggcgaattcgtgaatacagtacccccaggcgacgagacgggggtctcggtccgtcgaaaaatta