Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:324H1   

TH:324H1RNAiTH:324H1
PCR_productTH:324H1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK632.4 Source_evidenceePCR1043WS150 Sequence/Annotation Release
Overlaps_Gene ZK632.4 Source_evidenceePCR1240WS150 Sequence/Annotation Release
Chunk_score Abs_score1156
Max_abs_score1156ZK632.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII98053079806956
Overlaps_transcriptZK632.4 Source_evidenceePCR1240WS150 Sequence/Annotation Release
WB_DNA_textTH:324H11650tgaaattttaacgaccggccaggcagcgctaatcgtaagaaagaaggaagtaatgtaaacaatgaataaaaatcctcaaataattattaagaattgaaaaataaggaataaaaatttattatgaacaaccctagataatgaaaaacagtgactagcacttttgtatgtaattgaaattccaaaattccaatttttagctgaaataacgtggaagctatagcatggcaagtttaatttttaaatacaatcattgcgtaaaactgtggtgaattatataaagacataaaaagatttctgaattaatcaataatcagacgcttatttgaaagactttcgagggctcttggtgatggtgtgaacgctcggaatgcaagaaaatcatcagaaatattaatcttgggacgttcagcgtcatgtgtagctccaatgaaaacgacttctcctcgattcaatacttgtgatgcatctcccaatgtaactgttgcagtaccatagagaaccgtcaagacagaacatgattcggagtaaggaagttggtagatcgatccagcgggtcctttgacttcctgcacccagaactcatcaattccacgtggagtaaatagtagtgatccatcgtccagttcatttggaatatattttggaagcagggtctcatcataattcaacatttcaaccaatgattctacatcaatatattttggtgttaatccagctcgaatagtattgtcactgtctgccatacactcaacacaatctcctttcaaataagcatgtggcatgtttggttctaaaaatgttgcctctccaggttgtaatttgaagtagttcaagaaaattggagcaaatacaccaacatctccagggtacaatgtgaaaaggtagacaattatttcatcaagagccgttttgttttctgaaatttagtaattaaaaagaagatattcattcaaaaatatcgcttaccatgtccttgaattcgtctggcaagtttatcaacaactatttgaagtttttcctttggagttcgccaaattcttgagaagatctttttgagaacctgtgcagaactctctccataagatcctaaactgtcgatttgacttttctcttcttcggtgagcaattcttgaatttcagagtacactgaaaaaaagcaaattttaatgcttataatctaattgtgataattacatttcagatattcactaatttgtgaatgttgccgaaatccggaaagaagctcgaattcagtcagagcaattgcgatctctggtttgtggttgtcatctggatagttcttcggatctgtagcatgaagaagttttccttgttcttttgttggatgaatttggattgagagtggtccaagaacggaaagcactttgaagaggaatgaaaggttgcctgaaagaaataattaatatttattgacaaggtcatgttgttctttaaggaattgaaatgtatcaattggcttgaaatttatgtcattcggaagctgacatcgaattggatattcctttttgctgatctcttaacttccaaattacataagtttcaagccagttagaccattcccaagccagaacagtaaagaatatttattttattcacctttttcatgttttccctgtaactctggcgatg