Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:325A8   

TH:325A8RNAiTH:325A8
PCR_productTH:325A8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T28D6.5a Source_evidenceePCR650WS150 Sequence/Annotation Release
T28D6.5b Source_evidenceePCR808WS150 Sequence/Annotation Release
Overlaps_Gene T28D6.5 Source_evidenceePCR808WS150 Sequence/Annotation Release
Chunk_score Abs_score745
Max_abs_score745T28D6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1133997011341623
Overlaps_transcript T28D6.5b Source_evidenceePCR808WS150 Sequence/Annotation Release
T28D6.5a Source_evidenceePCR650WS150 Sequence/Annotation Release
WB_DNA_textTH:325A81654agcctcatcgagtagtccgacggacgagattccaaagtctccaatcgaagatccatgggatgacgcatcgggtaaatatgctccgccgatggtcctactgcagtccgacactccggatctaccgctggtgatgcaaaatcacacagggaagcggtatgaggaagacgaagtggatacggatttgaaaggactgcggagtggtggaagtccagtatttgcaaggccaaggtctcggagaggaagtcgaattgatgagatggaggggcagttagatattccagagttgaagccgttgaggtaattttagatccggataattcgtaacattctcccgatattcatcaatatttctaagaaaaaattcccaaaaattcagatccgacgaccctctggccgaaccactcgacgcgccggttccgatcaacagcatcaaaggatccgtcgacgaggaggatcggtggtcttcgagtgaggaaggcgaagtcgacgtttactataaaatgagcgacgatgaggatgtgacgcgggaggagttggactggaagaaggcgatggcgaaggccgagctggtgaaggaggccgagtcgcaaggaaggatgcttccagggtcggaggatcagcaggatctcaaggatttgaacaagaaacgaacagagacacctccatcctctccgattcagaatcatattcagaatcacttgaatcacaacaccgagtctgattcggaaggtgagattttttgagatttcaagttttttttttgaaaaatctaacttctaaacagtgttcttttcttcttcttttgggatttctctctctctctctctattccttaatcactttcagaagaggaagagcccgccagggtacaggatgacggaaaagacgccgaaatcgccgaaaaagatgacgatttcgtgtacgaacgtctccgagaggaactttctccccagcctccgattgtcgtggatttagacactgacttagattttgtgccgatgaaggtaacaccattttttgtcacataaatttactaactttccgattcttgtgcctgatgtgctttctaacagttcaccaatgttttccgcacagcttgaaaattctctagaaaaaccgattttctagctcaaaactgtgtaatcttgaatttactgagaaactgcaaatttcccttagaaaaatggagtttttttaagacagaaattctggaaattcagtttgacctctcgattttcagccaaaaatctatgttttcagctaaaaacatcaattttacgccaaaaaatctgaatcttcagttgaaatattgaaatttcagcaaaaaaactttgggatgaaaatgatgaacttggagccaaaatctgttatttcgaactccaagtctcaatttccagcaagagtgggagaaatgagctgtatgggatttatgtattagaggaaaagttttacattttcagccaaaaatccccataatttcatccagaaaacccataattttttaccggaaacctcaattttccagctaaaaatcccccatttttccgccaaaaacctccaattttaggccaaaaaaatcctcaattttccagctaaaacctccaaattttccagtcaaaaacctccaattttttcgccccaaaaacctcaattt