Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:325D7   

TH:325D7RNAiTH:325D7
PCR_productTH:325D7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R10E9.1 Source_evidenceePCR1050WS150 Sequence/Annotation Release
Chunk_score Abs_score968
Max_abs_score968R10E9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII39650583966736
Overlaps_transcript R10E9.1.1 Source_evidenceePCR1050WS150 Sequence/Annotation Release
R10E9.1.2 Source_evidenceePCR1050WS150 Sequence/Annotation Release
WB_DNA_textTH:325D71679ggagaaggaggagcaaaaagacacagggagaaaacaaaaaaaaagtctcagttttcgaacaccgggatcaaattggttgggggctattattctatttttctagaaatttcaaagaaaaagtcattgtcaaaagtctctcttgagcaattgcaaaaaaaatcgggggggcttggtccgtgatcctcatgagactttggacaaaatgggtcggttggatggggcgcaaaaaacttgagtaaattgaggatggagaagaggggggcgaggggcgtctactgaaagaaaaccatctagaagcgattgaatcacacttttctacactttctgaaagggatggaacacagagaaaattgattgatggtggatggtggtggatccataaggtatccaccggagcaaatagaaaatggagcaaaaaagcgagtagagtctagcatggtctaatttttaagagattcagaaacactatccgaatctcttactcacaaatgtacttattcacactttttacattttgttacacaacagacgcgaagaaaatgggtgggggtgcaggaaaaaattgaaaaaaaatttgaaaaagaccgataatccaataagaaaaaagaatcttctaatacttgctgtgactgtggtaggactgttgattcatgaacatttgtgcttgtgaatccaagagttgtccaccattattcaggctgtagaggcttgcagtgtcaaattgatggggtggacgattggatgaaccacctggagtactcagaccggaatagcctcctggcatgttgttgaacactgaaagatcttgagacaagttaatttaaggatcaactagttgggtgttgatctactacagttattagttttttgtttaggcataaaaatgtcttggaacatctatatttcgggtctagaaacaggtcggctttataggcacgcaaataggcaggtagggtgcttgcctaaaggtcctacttctaattacaagtatcatatgttgaatgttgttaaaaaaggatgtcatctattcatttcaataataatctaaatttcgtgaagttagtgcatctcggaactgtgcctatctgattcttacctgcatgcctacggcttattattttctaaattcagggattcaatgttgacttgccctaatgcctaagtgcctggataatgcctatcctacgagagacctggtgaaagcacaggatgttagttaatttgttgatatagtcacgattaggcagtcattgttttttctgttcatttctaatatatgctcaccatttgtaaagttaggatacatcaaatttcctccaaatcgtggcaagtactgtgcgtaggcgagcagagtctctggtggcattccatataaatttctggccgcagcagcccgcgacttgtttaattgcaccggaagcatgacctgaaatgttaagtgttctgttttgttgtctgtgcagaaacgaaataatgaagcctacctcctttggctgtgcttttttgcattccaccatttttccattaatctcgtgaaaatgaatttcgcacactttatcggctacctcgtcgctatcaaatgtgacgaacccgaatcctgaaattttttaaaactaagtaaaaagtaaaaaaattaaagaatgtgctttctgcacaattttcagcagcaattcctcaca