Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:325G5   

TH:325G5RNAiTH:325G5
PCR_productTH:325G5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSBE10.2 Source_evidenceePCR729WS150 Sequence/Annotation Release
Overlaps_Gene BE10.2 Source_evidenceePCR729WS150 Sequence/Annotation Release
Chunk_score Abs_score666
Max_abs_score666BE10.2
Specificity_index0.905
Rel_score1
Map_statusUnique_ePCRIII1279483412796525
K12B6.7 Chunk_score Abs_score70
Specificity_index0.095
Rel_score0.105
Overlaps_transcriptBE10.2 Source_evidenceePCR729WS150 Sequence/Annotation Release
WB_DNA_textTH:325G51692tgaaagcgctgtgacaaacgcgacgccgtgcgccggtggcggcagcgcatatcagtgtgcgctgccgctggcgcaagcgtatgaaatttgcgccggcggattttagacgaatttttttgagtttcaatataaaattcccgacaaaaatgaataatcgtcagaatattttttttagtttccacacttacttcatatcaaaaaatgctccaaaacattgcatcgtaaccacaaagtatgcaatcttgactgtacaatccaagtagctcaaatgattccggtcgtattcaaaatggaagaatatagccaacaacaacaagaatgacgatgccacgtaaactttcactaggatcctcgcaggtgggctgtatctgagaacaggtttctctggctcaggtactccgtgagctggattaaccatgctcatccaatgaaagaacggggtgacaggaacccctgggaaccagcccggcgggaatacggttgctttcaatttgttcacaactccaggaaacatgggctctcctttcacatcttttgtgaatcctttgaaaattaaaatgtcccaaagagcatggaattggaggtagatttgattgaaagtgttctcgttggtaactaatccatagattggtgggtcatcgtgacgttcggcttcaaatgtgttgaacatctggaaatgacaaaaaaaactttaaagatgaagttccacttgtgggtgatttttttctcacaaaaaaaattggcgcaaaattcaaattttctgagaaaattcacactttttcagtctgtttgaatttttgcgccaaaatttttatcataaattttgaattcagcggaagaatattttatcctccatatgaaattcaaattttttgagaataattttggcgagaaattaaaatttcctatgaaacggtttgggcgggaaattcaaattctctgtgaaaaaattttcaacaaaactttttcttgtgggaagttcaaaatttacgggaaggaaattgggagcaaaatttaaaattttctgagaaattcaaaaatttctaattttgcgccaaaatattcttgcaattttaaatatttggcgggtaatttgaaattttctgaacatctttttgccgggaatttgaaatattttaaataaagttttggcgggaaatttaaaatttctcagaaaaactttggcgggaaatttaaattttttaaaaacaattttggcgggaaattcaaattttctcggaaaaactttgccgggtaattcaaattttttgagaataattttggcgggaaattcaaatttccagtgtcaatttttggcgggaaattcaaatttccagtgtcaatttttggcgggaaattcaaatttcaagtttgtttgactaaattaccttatcccaaataatgaaaactcctccataattcttgtcaatacaatacggatttcttccatgatgtactcgatgatgagacggagtgttgaatactaagccaaggggtcccatggtgtccaccaactgaattttaataattttttaataaaaattgaaactaatatctaacaattaactcaccgaggtatgcatgataaattggaaaatctccgaaaaatatcgatgaactaaaaatattgatggagggatgaagaatgcctgaatacagtcatagatcgctaatccagcatcttgtatggca