Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:326C4   

TH:326C4RNAiTH:326C4
PCR_productTH:326C4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY45F3A.5 Source_evidenceePCR246WS150 Sequence/Annotation Release
Overlaps_Gene Y45F3A.5 Source_evidenceePCR246WS150 Sequence/Annotation Release
Chunk_score Abs_score183
Max_abs_score183Y45F3A.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1058560110586309
Overlaps_transcriptY45F3A.5 Source_evidenceePCR246WS150 Sequence/Annotation Release
Overlaps_pseudogeneY45F3A.6 Source_evidenceePCR26WS150 Sequence/Annotation Release
WB_DNA_textTH:326C4709gaatacaatttgccggacggcaattgccgtccacacctgattctgagtgtttttttctggataggccccgcgaaaaaagatctggaaaagtgccaacaaagcagagaagttaagagtttttatattttattgaaaaataaaaatagatcaattcaattccacggagctactggtgatttgcagcttgagcagcttcccgagctttttgagcggcagcacgagtaaccacaccttgtgcggggggctcactagtctgtaatttaaatttgatagcgaaagtagcgaaattttgaattcctgcaagaaaatctagaattcaaattcccacacgcaaaaaaaatgttttaattgagttttaaattcccgagaagctgatgtttcagattaaaaatttcgggctcaccttggccttctcggctttcgccttacgtgcacgagccgcaagctcggcaccattcttctgctgcttttttttctctctctgaaaaattcaaattctcactaagaaatttataattaaatttttaaaaaacggttaccttttgtttggccgcaagattggcgatagccaattttttgtctcttctctccttcctctccttatccttgatcgcttccatcgcgagtttgataactatttaagaactgattttgtttgaaaaattaaaaggggagtgaataataagcccataggcggtaaacgactggt