Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:326D12   

TH:326D12RNAiTH:326D12
PCR_productTH:326D12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC29F9.10 Source_evidenceePCR493WS150 Sequence/Annotation Release
Overlaps_Gene C29F9.10 Source_evidenceePCR493WS150 Sequence/Annotation Release
Chunk_score Abs_score676
Max_abs_score676C29F9.10
Specificity_index0.749
Rel_score1
Map_statusUnique_ePCRIII106960107597
C29F9.11 Chunk_score Abs_score81
Specificity_index0.09
Rel_score0.12
T12B5.6 Chunk_score Abs_score73
Specificity_index0.081
Rel_score0.108
T12B5.8 Chunk_score Abs_score72
Specificity_index0.08
Rel_score0.107
Overlaps_transcriptC29F9.10 Source_evidenceePCR493WS150 Sequence/Annotation Release
WB_DNA_textTH:326D12638gctccaaaagggttattcgttcgaattggtcaattgacacaatgaaaaccaattcaatctttttgagcattttagcatctaaccatgaaagaatcgtaaggacttcatcaaaaccgaaattccaaagttctatttcttttacgtgaatacatttttcggctttgaaaatcttaatgaaagttgtaacaatgtcgcatctatcatccgtgttgttccaaattgtaatgttccgtgcgtgcttcgatactatcttcaaatccttgagcgctctatccgcaaagtcttctctatcaattaatttttcctgttcattgtggatcacattcgaattaccatttgcagcagtaatatatctgcttgtagttccactcaaattcatttcgacttcatctttcctcaagtacaaatcgatgcaatcaaaacgtaatccaaatttatcgacagcacttctcaaactgcgacagacttttctcgctcttagtctgtaacacataatgtttaatgcaatatgagcatttcagaaaacaaatgaatagaattgtgccaaagaataattatttcttaaactctacacagcacattcaataatcagttttactttttacagaggaaatacgacactttacatggctcctgcg