Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:326G11   

TH:326G11RNAiTH:326G11
PCR_productTH:326G11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene (8)
Overlaps_pseudogene B0280.6 Source_evidenceePCR759WS150 Sequence/Annotation Release
Map_statusUnique_ePCRIII71051007106576
WB_DNA_textTH:326G111477ccgtgtacccattcagaggcgcagagatctgcaggtgcgcatttcctttttatgagcttgggaatgaacgaactgctcaatttgcccctcactcgtcccagctactatttaccacttttgcacattctgtcattctttggataacagtatcatttggggacatggagtggcaatatacagttctatttaatatcaggttgtcccataagtttttgtactattttttttttgaaaaaaatttatttctctcaagcgacaagtagtactattcacacaagtattcaccattagtgtccaccacttgttgccatttactaggtaacatcatgatgccacgggagaagaaatccggcgaacgcgatgagaagaaagtggagagttcagttttgagatgctcttcgtcgtcgaattgcttgtcgcgcatgtagtcactgagagacaagaacaaatggtagtcggttggtgcaagatctggagaatatggtggatgcggtaaaacagtccaaccaagatcttgcagcttttggaaagtcttcttggcgacatgaggcctagcattatcgtgaagaaaatatagtttttcatattttccgttggtcttttctgcaactcggtccaattgggcacaatagtaatcagcagtgatagttttattagttggcaacaattcccagtgcacgggtccttgaacaccccaccagacacagatcataatcttttttgggtgaagatcaggctttggcgtcggtattcctttctcaccgatcggaagccattgacgttaactggaacggttaacatagagcacccacttctcatctccagtaaccagattgttcagccaatcgaactttcgacgaaaagttagaagttgagtacaaacgttgacccgagtgagcttctgtgatgccgaaagttcatgaggcacccaaattccaagttttgaagtaaaaccaaggcgacccaagtgacatgcaattgtgctatgacaacactcaagcttctcttccatttcacgaagactaagacgaggctcttcctccaccagcttcactaggtcttcttcatttaactctaccggtcgcccagaacgttctatttcttcgagactgaagtcgccgttcttgaacttttgaaaccaactctttgctgtattataagagagtgctccctcacccatcgcaccgcatatgtttcgttccgcttccattgctgaatgaccaagacgaaattcataaagaagaagcaatctaacgtctcgacgttcaagtttgatgattgtcatcgtggcaaagtagaaatggatgaaatgaatcttttctgaaaggggacgacccgaccttgacacgacctacgatgaaaaaattttaaaactttctagaagttttggaaaaatatttgaaaaaaagtacaaaaacttatgggacaacctgatagtatgttctgaagcgagggtctaaattgtgtgcccgagttt