Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:326H11   

TH:326H11RNAiTH:326H11
PCR_productTH:326H11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0524.3 Source_evidenceePCR814WS150 Sequence/Annotation Release
Overlaps_Gene B0524.3 Source_evidenceePCR814WS150 Sequence/Annotation Release
Chunk_score Abs_score772
Max_abs_score772B0524.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII18888671889964
Overlaps_transcriptB0524.3 Source_evidenceePCR814WS150 Sequence/Annotation Release
WB_DNA_textTH:326H111098gctaaactccttaaccccgctgatctccaacattggcaaaatccaagttgacttaactttcaccaagcatgaaggccttcatagacatttcatagacgttttgctcgacatggagaagctcgcagatatgatagacgcgctacaaaaagccatggagttctgggattccaagaggttttttgggaatcaggatcagatcacttcacacccacctgacctaaaaattctcactacggaatctatcgactcagttgcagaacgtattataaagtactttccctctttcgaacagtttacaggggaaatgcccaagtttctgaaaatcgtggcttcactgaagaaaatcaatggaatagaaatggtctcgcctgccttaaaagctttcaagttccttagaatcagagatgctttggatattgatctcatccggattcaggatgccatgaagaatctggagcaagagatactggcggttcgagggataactgatgagttctcaggacttccggacatctcgaaacactctaagatcctcgatgaaactgtagattggcttggttatcttctagagactaacctgactgaattgggagcttcctcggagcttcagcaaaagatctcagacttcaggaaacaaggtggaatcacctcaacacgacttgtagactatgttccgatatttgcacaagcaaatttgccgaacttgccgaattcgccgtgctcggcaaatattggaaaaagagatttgcggaatttgccgaactcggcaaattttgagatttgccgcacacccctggtccacacttcttgctaaaactcatgtatctctgaaacaaaaagagatatcaaaaagttgttaactattaaattgtagaaaattaaatttacacttgacaactttttgatagctctgtaaggtatagagatacaggggcttgaacatggcgaggcttgtaggaggtctccgtgcctaaaactgttttacctcaaaaacggtaaaactggaaaaacccttgccaactatttaaatgtagcaaatttaatttttaagaaccagacccatgggatgaggaagtggacgatttagcgagtttgagg