Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:327D1   

TH:327D1RNAiTH:327D1
PCR_productTH:327D1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F10C5.1 Source_evidenceePCR580WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII480572481675
Overlaps_transcript F10C5.1.2 Source_evidenceePCR580WS150 Sequence/Annotation Release
F10C5.1.1 Source_evidenceePCR580WS150 Sequence/Annotation Release
WB_DNA_textTH:327D11104cagtgagcatgcgatcaagttcttccaacgagctctccgtcttaatccgggtctcgccgcgctttgggtactcatcggacacgaattcatggaaatgaagaataatgcggccgcctgtgtttcgtacagaagagctattggtagggaatttttaaaaatattttttttcagttttagactaagactgatattttaaaaaaatttctcaaatatcgaaaaaaaagtgttttttttccctaaaattatcagcctaaatttttttggtttagaaaaaaatctgataaaaattgtctgaaattcgattttttcccatttttttaccatgtaataatttttcaatattatctaaataacaccaaaaatctagattttttaatatttggttgaaataagatggttttgcaggaattgattaaatagtaaatttcttttaaaaaatctggatattcacggaaaatataattttttctccgcttttaaatagattgaaaccattttatttggttttgagaaaattttatgaaattcgaattttttttcttaaaatgtttttattaaatttttagattttctctgacttacacaaaaatctaaattttgtgaattttcaacaatgtatttatttgcagaaatcgatccagcagatcaccgtggttggtacggcctcggccaaatgtatgatatcatgaaaatgccagcgtatgctctattctactatcaggaagctcaaaaatgcaaaccccatgattctcggcttctcgtggctctcggtgatatatactcgaagcttaatcgcattgaagacgctgaaaaatgtttcaccggagcatatttgtttggtgatgtggaaggaaacgctttatggagcctggcaaaacttcatgaacgatattcggatgataataaggccgcacaagcttttgaagtttttttggtggtttatgagcttgtcacgtctgctgaggagaagattatttatgcgatcgcgtttttggcgaatcatttcttcaaaattgaagatttcgataaagcctccgaatatgcaacaaagtgtttggcttttgaaacggtaaaatttgagggttcagggtgaaaatttgggaa