Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:327F10   

TH:327F10RNAiTH:327F10
PCR_productTH:327F10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF30H5.2 Source_evidenceePCR318WS150 Sequence/Annotation Release
Overlaps_Gene F30H5.2 Source_evidenceePCR318WS150 Sequence/Annotation Release
Chunk_score Abs_score276
Max_abs_score276F30H5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII485954486638
Overlaps_transcriptF30H5.2 Source_evidenceePCR318WS150 Sequence/Annotation Release
WB_DNA_textTH:327F10685tgaactttcggattttcggaatgttttaacgaatcctatgattttcacaaattcggtctgtcaactgattagtagaatcgagtgccactgacatgcctaacaataatggaaaaacatgatttcgcaaataataacaattcttgagaataatatatacaagtggtttattaaaatttgtgaaagaataaataaaaatatcagatattgaagggtttactttccccatccacgtcgtcctcctccatagaatccacgtccacctccgccacgtccccagccacctccacgtcctccccatccaccgccacgtccaccatatccacggccgcctccgcgaccccatccaccacgacctccccatccaccgtaacgcttcactcggggtgattcactggaaaaaggtgtatgattggagattcattataagaaagaacttactcagcggctccattttcatcaaatgctcccattggctccatatcaatggagtccatagttagcccatttggaaaagagaaaaccggcaaggcggtcaatgcgataagacagaatacaagtagcaagttgaattgtctcatggttgatttgatttttatcaatggatttttatcgcttatatacccccggagacggtgatctttaatgattcggcgaagtctaggagaaggcgttggagggatgatat