Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:328A11   

TH:328A11RNAiTH:328A11
PCR_productTH:328A11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39A3A.3 Source_evidenceePCR643WS150 Sequence/Annotation Release
Overlaps_Gene Y39A3A.3 Source_evidenceePCR643WS150 Sequence/Annotation Release
Chunk_score Abs_score518
Max_abs_score518Y39A3A.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII20667072068190
Overlaps_transcriptY39A3A.3 Source_evidenceePCR643WS150 Sequence/Annotation Release
WB_DNA_textTH:328A111484atggtgtatgtttttgccggaatcgtgtattgcgagttttcctaaaagtatatctttacttaaaaagtcttaagaagaaaaaaaccaacttgtcgtgggttcataacagcatcctttattagtggcaatattttggtaacatttttcattttataggttgtgcctgtttccgataaaccatatcgctggacactgtagatgatggctgggattttagatttgtcaaactttgttttgtcaacttatgatacttataacagggatgggcggcaattgccactcggtaaatcggcaaattggcagcttgccgatttgtcagaaattttcaattccgacaatttgccgatttgccggaaattttcaattccgacaatttgccgatttgccggaaattttcaattccgagaattggccgatttgccggaaattttcaattccgacaatttgccgatttgccggaaattttcaattccgacaagttgccgatttgccggaaattttcaatttcgacaatttgccgatttgccggaatttttcaattctgacaatttgccgatttgccggaaattttcaattccgacaagttgccgatttgccggaaattttcaattccgacaagttgccgatttgccggaaattttcaatcccggcaatttgccgatttgccggaattttcaattccgacaatttgccgatttgccggaaattttcaattccgacaagttgccgatttgccggaaaatcgtgtgccgcttacccatgactaataagcaattatttaactgtttcggaaaacttagtatgaaaacctgaaaaatttggtttttcggcatgctgaatttaaatatctcgatagttttttactaaagttgttcaattttccaataaaacttacaatcagcaacagcacttctctcctcttgagtcagcatttcatcttctccatcactcgtagtaagggatatatttagcttgaagctatcagtaactgcattgggacctaaaaaaatctcatttacttcacactctattcacttctgcccagaaaaaatccctaccttcccgattgtcccgctctgcagcaaaattcaacgagaattccggcttgcattggaaattcagtacttttggaagcttacagcattccagaaaatccttcaaaaaagtttcaaatgtttgaagcccaccatctctcttatcctttataccacaaactgcaaaacctcttgagcacgatgcaccatgccaggcatcgttggtgtgctcgcacagctgatgtgtgtcaccgttttcagtgcggaaaagtccaactatgactccggagcccgagcagtacttgatgttgccgtcggtgttaagaggatccatctcgatgcttaagctggctgaaatttcatgaaataggcaaataaatgtataagtttatttacaagttccaaattttctgcaaaaaatttccagaccatcgtttccaactcgaattc