Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:328B6   

TH:328B6RNAiTH:328B6
PCR_productTH:328B6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST17A3.3 Source_evidenceePCR1070WS150 Sequence/Annotation Release
Overlaps_Gene T17A3.3 Source_evidenceePCR1070WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII139797141240
T17A3.7 Chunk_score (3)
T17A3.4 Chunk_score (3)
Overlaps_transcriptT17A3.3 Source_evidenceePCR1070WS150 Sequence/Annotation Release
WB_DNA_textTH:328B61444taggagaggggagtctgggcgagggcaatctcgagatgtaacggttgaacccgactctcaaagtaatctattttatcgtattttcttcactacagtgcgcgcaaactgtataatcatttactgctctttctttttactcatatataagttgctttacgttgggcctaggacatggcctagtccctaccacccagatggagataaagagatccgcatttaataggcaggttaggagcatcccgcctacaattgtagcacttcaaattaagccttgagtttaataactttattcaaaacaatcactaaagaagtacacacttgttttcgagtaatttatcatttccacacgaacatacgcaaatattgaaacgtttcatcgacagtgacagttgcaatggttccatcgttccgtctgatatcaaatcctccagcttcaacgacaatagtttttataggccgattgtcggaaaaaacccactccttgtcggttggtgccaattgatattcaataccatttaaggcaatcaaaagaaattggttttcagtggaattggcgggaagattcattacgagatattccaaacggttgtttgatccattaatccaatgttttagaaacaagcatagttgctttgagggacatcgtgtaccaatacgcattatatcaatacgcatttcagaaatatttgaaaccaacaaatcttctagtttcaaggcaactctttccagacagaaactattgtagttaagactgacaattgaatgaaagactttaggtttcaatgaatgatagtctagagccagcttatcaaattggcgtgaatagttaaccaataggcttctatgaagcttggagttttgcatgaaattagaagaaatgaatagtttgcaaattttgaaatctttcaattcttgcaacaacgtttcgtagtcgtaatcgtaagtaatcataagcatataaaattcagatttgtggaatatttcaagaacatgatttgcgatctctttgaaacgaattcccgacggtttccaatgaaatatttcagtttcctcaggaattgggccttttttcactttcatataattcagttttttgtttaatttccgcggctcagactcaatcatctcgtcgggaatttgaaacgtcaatggaaaagtaccatcaaactcaacaactagtcttatcgttgacgttgacaaatacatatcaatacaggaaacgttcatattcaactcctcaacacgacgttttgcagtttttgaagagaatgagatgcttactctgaaaataaatagttatgtatactttgaaaaataaagaagttaacttacacatctagcattttcatcgtttgaagtaaaaaacgtagaggttttgaaggtaatcgaagaattggaaaaccactcgtcatgtttgtaaagggaatgaatgactggaacggga