Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:328C1   

TH:328C1RNAiTH:328C1
PCR_productTH:328C1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T24C4.6a Source_evidenceePCR1328WS150 Sequence/Annotation Release
T24C4.6b Source_evidenceePCR1328WS150 Sequence/Annotation Release
Overlaps_Gene T24C4.6 Source_evidenceePCR1328WS150 Sequence/Annotation Release
Chunk_score Abs_score1286
Max_abs_score1286T24C4.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII883495884951
Overlaps_transcript T24C4.6a Source_evidenceePCR1328WS150 Sequence/Annotation Release
T24C4.6b Source_evidenceePCR1328WS150 Sequence/Annotation Release
WB_DNA_textTH:328C11457ttttaaacgaacttgcccgttttcttatgctatgtcccacaacttctgcaatttctcctaaaactttatgtgtgctcactcacttattttcgacgtttctgatattctcgagcaccgtattggccagcgttcgaatgtcggtggtagtgattgcgttggaaacaagttcctcgagcagaggaacacctccttcatcacgtacatacgcgcaatatctgaaaaaattcaataaaactggacatttatagagataattattacttttctccgtcggttgttgtcaagttagccagtgcccaaactgcccagtgttgactcgcataagcatgataaagtggtaagagccgtaaaatcgggcggaatgaacgataatttataaagcggcgggtggccagcttccaagaagacgttgcttccacaattcgttgcataacttcattacgacaaactgtcatttgcttccaaacttcttcaccatcgctgaccatgtgtgccagaacgccagctgagttgtagctgatctctatggattcctcctgtgattccagtaatgcgcagaagattttcacatagtcgtctttcatgagttgcgatcttaactcatcaacttcggcaatgtttccgatgaggcccatcatgtttcgaaccagctctcgttcagttttgaaagcctcgtaacacttttgaaagagatccaatccatttgcattcaggaagagttcacaatttactggtgtctcatcagttatgttccaaaggaaactccatccaacttccattacgtcatcacaaacgttagcagtgtgttttcgtgcgatttggtccagaatcatctctattgcaccataacttccaacttgaactttctgatcaccttccacatggcacgccatggaattcaaaaggaacactactatacgttgtgtcaaattatctgcattatggtgttgtagaacagataccagaagaactgcaaggcggctataatcgaacaaaatgtcctgtgggatctcaaattggcacagggacaaacagcaattgcgaaccattacttgctcttccatatgcacttccattccactcaacaatgccgacacgactcgtcgcttcgtgtctcgattcatatcgacttttctgataatgtagaacagacttgcggatccagcgatttgaagtgtgctatctgccaagtgacgatgcattgcctctagaacgagatgcagagcctcggtatgacgtgtcaacggattactatttccgaatcgatacaattgataactctcgtttagcacgttttgcaataaaccagcccgatctttgtacatttggagggaagtgatcacttgatcctcgttcgcatctcctgacacaacttctgctggtatttctctgacatggctggcactttcacaattgaatagacccagatatttcaatgggcggactaatgattggag