Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:328D7   

TH:328D7RNAiTH:328D7
PCR_productTH:328D7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST19C3.4 Source_evidenceePCR618WS150 Sequence/Annotation Release
Overlaps_Gene T19C3.4 Source_evidenceePCR986WS150 Sequence/Annotation Release
Chunk_score Abs_score883
Max_abs_score883T19C3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII618409619894
Overlaps_transcriptT19C3.4 Source_evidenceePCR986WS150 Sequence/Annotation Release
WB_DNA_textTH:328D71486tggaagatttggaaggcacaaaaataataagacaattacttggaaaaatcgtttgaaaatctatctcgtcttgattgcaaattccaatcaatatatgtgtgacacgtagattaggtcggattttccaagaaaggggcgaagttctaagctattatgtgatggggaaatgggacatggggtcttttttttaaatatttttattttgatgaaatttcaaaaaattttaacatttttggaattttatcaaaattatatttcaattatcccattacaaataaaaattcaaaaaaagtgtaacccatgtcccgactcgtttggctgattttgcgtaggataccctaatcctgggagatgtcggttgctgcttttcaatgaattggtttcctggcggatctgcgtggaattgtagcagcagttgtaaattcactatcagctccactatcgatagtccttgatcttgaacgagatctcgaagaagctcgacgacgtgggcggggcgatttttggagatctgtgtcactgttctcgtccagctcctcgattttcacaatgttaatgtttttcgtgagagcttcacgttctgagccaacatcgttagcactgtaggatctggaaatttttgaaaagttgacgcttccggaattggtgggtccttacctttgaagctgattcactaactgctgctgtccccgaactgcagcttctgccaccacatcctttgcatataccaggcttttacttccgattcgcattaactgaaaaccaaatttgattttttgaaattggatgaattctcgagaaatttccaaaaatattacaaaaacaattttattggtgtaatttttcaaaagaagttgagtgaaatttttaaaaaatatgtgaaattttataaatttgatcatataaagaaaatcaatttaaaaatatatgcttaagtttagaaaaaatgcaatatttacctgattatacgattctgattttgccgattccagcagcgcgtcaatgtccttctcgtgtctgttgagtgttgggtggacccactgaaatttttttcttttaatatatttttttaattgaatcaaaacccacttttctgtacaaaatagatgctcctttcgtccatggacttagcagccaaaaaatgaagacaatcttcaactggaaatagaacgggaaccagaaggctaagactaaatccaggaggttttcaagaaatgagtaaatggcaaatacaatccaatacatcatccattttacgtactctcgtgtgtcttttgttcggactgcctgtaaaacaaaacattgatgttattcagcttttgtctatgtcagattcttttactttaatttttttttaataaatgaagagttttaagtattgcgaataaatagttgtacattaaagttatcaatttttaagagcagctaccaataaaaaaatcaacgagcaactgtctttgtcaaattcccatttccgctgatcttt