Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:328F11   

TH:328F11RNAiTH:328F11
PCR_productTH:328F11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC155.7 Source_evidenceePCR990WS150 Sequence/Annotation Release
Overlaps_Gene ZC155.7 Source_evidenceePCR990WS150 Sequence/Annotation Release
Chunk_score Abs_score885
Max_abs_score885ZC155.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII52073475208843
Overlaps_transcriptZC155.7 Source_evidenceePCR990WS150 Sequence/Annotation Release
WB_DNA_textTH:328F111497ggcaacataatgaatccctgctctagagtgatgtgcacgagttttatatagagaacatttttaattacagattaagtagtggaagaattttaaatttgaataaaacaaggaaatatctgcattacggaatctaaccggaatctaaaattagaatttcattgattgaactagagaaatcaataaaatacccggtttattcaaaaaatataaataaaactactgaagtaaaagaattacaatttagtaacaataataagaatcagtacaaaaataatggcaacagtgagcatacaaatacaatgcatttttttgtttcctttttgatatcgttccgctttgaagacatcttcaactgctttcgacacacgaatcgaggtctgttcaacattatagtctattctgaaattaaaatttactataattgaccttaaagcttcgttttacctatcaatgacgcttccttgatctacaatcatttctgataaatcctggaagagtgtatttaattctctaattgatgtgttcacagccatcacttccttttcgcgctctcgaacttctcgatcgttattcataaattgttgaagctgggccattgatatttctgtagatggtgacacatctagctcagcccaattgggagcatcaatcagtggatctgttgtgataaggtaattgtccacgttacgggaacgattctgaaacaattttgatgtgctgaatgaaactttttcaaatcgcttacctggatatcactcaaatatttcagttgtcttcctctaaattcatcggtaatttggctaagtgttaggctcagggttgcagcagcattttctcttaactttcgctgcataggtttttctttgttatgacttccagatatcattctggaaaattttgaattacctaagtcaaaccgagtctgtaaataacaaacctgattagcctttgacaatgtgtgagcatttgagtgatttgctccgtcgtctgttccatttgcttctcttctttttcgaatgcttcatctccaaaattaggtcgcgaaatgtgttttctctgtgcctctccaagttcatctagtcttctctgaactctttcaacttcgaattctacttgatcagcagtatgaatccaaactggctcttcatcggattcttgtcgcccatcttcaagttccactaaggccattcgttcttctgaaaaatacattattgcagactgcaattcgcagtacagaatttgatcatttgaaaagaagagattttagaaaaacctatttaataaaagtcatttaatgaatatttgaaccaattcagaatactcaccatcaccacgactcctcacaattatatctgtatcatctttataaattaatcgactttgatgagcatttgaacgtaaaagcataaaaacttctgtcaaatttctcgttgttccgtaaatttcatttttctttgcagcatttgcagcagcggtaacagaagaggaagccatctg