Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:328G4   

TH:328G4RNAiTH:328G4
PCR_productTH:328G4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12B5.13 Source_evidenceePCR753WS150 Sequence/Annotation Release
Overlaps_Gene T12B5.13 Source_evidenceePCR753WS150 Sequence/Annotation Release
Chunk_score Abs_score633
Max_abs_score633T12B5.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII947694949107
Overlaps_transcriptT12B5.13 Source_evidenceePCR753WS150 Sequence/Annotation Release
WB_DNA_textTH:328G41414ttttggcttattccaagcgtattgtgttcatcatttccatttcttttccgtttttttattttgtttttcataattacactgtttattaatcaaattttgacaagaaatcgaaagtctttcgaaataaaacatacaattttttcagagctttcgcatgaaaaaccaaagaatagaaccagtttcaaagtttgcattatcaattgaatacttaatagagaactcattgccgccagcatagtccggtttgaacacgtttgcaatttcgattgaatttgactttgatttctcacatcctatgtcgcaaccttaaaattcacattttttcattagatcctgaaaaaacgatcaattatcaaaaaacacatatccacaattccaacgtacatctctaatttcagttgcaatatttgttggaaagctgtccagttggatctcgaaccattttaaatgaaacagatgtacgatttgtctgttttcgagtaaagaatcatacagatgtaacttttttgcacatttccatagatccagggaagtgatgttccgtgcagtcctgacaccatttagtcatgaatgctctcttccttttgaataagtacaaacaactcagaatttaagattgtttcaaaatgaaaatggaacattaattgtctatgtttttggaaagactttttttgcagaaatgcataaataattttatttttatttttaaaaaaattgctaaaaaattaaaaaatttttcatgaaatatacatgtcgttggaagcaaaaagaacagtacaaatctatgtttagattttttattaatcaaatttttacgaatgtctattacaattaaagcttttcataacttttgcacaaaaaaccaaaaaatagaaccatttaaaaagttgcattgaattccaaaattaacatcatcgattgaatattcaattgaaaactcatttttgcaattttaattggattaactttgatttgtcacattgtatacggcaaccttgaaatgtgctttttcttatgagatcctgaaaacaattaattatcaaacaaataaacacatttccgacttacatctctaattttaatcgcaatatgtgttggaaagctgtcgagattaatacagatccattgaaaatgaaacagatgttcgattcgtctactttcaaagatagaatataaaagaccaaacacttttgcacacttccattgatccagacaaatgatactttcaaattggccatttatgtcggtaccaaacaattcaatgttttccagaacgttcgtatcaaaacactgaagaatattgacaacttcattgggcgcgtgataacaaaaaaacctttggtccaaaaaatttataatttaatttcggacattctttatatgcatcacaaaaaaactggaccaaccgatttga