Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:328G8   

TH:328G8RNAiTH:328G8
PCR_productTH:328G8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20H9.6 Source_evidenceePCR1092WS150 Sequence/Annotation Release
Overlaps_Gene T20H9.6 Source_evidenceePCR1092WS150 Sequence/Annotation Release
Chunk_score Abs_score1071
Max_abs_score1071T20H9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII22470702248276
Overlaps_transcriptT20H9.6 Source_evidenceePCR1092WS150 Sequence/Annotation Release
WB_DNA_textTH:328G81207cggaactacgactcctgctcaaatcactgcaatttctgtagataagttgaaggggattgttgatggaatcaataggctccgtgagctgaatgttgatgataagatgaagcagctagaggatcgagtgacactttatagttcatttgttgaaaaaacgaagggaatggagagtgctaacatcttttctaacaaagatgaatatgaggctcaattgaaacaatttcaagaaaaagcacaaacactgaatttgcatcagctggaaagttatttttatacaaatattgatatttttatggcgtccttaaatatattggaggctacagataacgaaaaagaagctgatgaagattttagagaggtgattcgtcttataaaagaattaaaccgttcttacccagactataatccactatttgaatttgaaaaacttaataatcctcaaaatagttttccacttctatatccagtttatgagactattcaagagtattccaaaatcagtgaaacactcgagaccacgatattatctggtattcaaaagaatattgataatgttatcaaaatagccaagtcagctaaattgaatgcagaaagtgttgaacaactttccaatatgttattgtctcgacattccaaatcaactaaagcttccaaacacataactgggtttttcaatggcgattcggatatttggaatattttcgacaacttgaaaacggattggataaataaaacagtgtatggacaagcggaacacattggtaaagctttgcaaacactaaagacagttcaaaccaacgtgcaagattctaatgaatcgattagaagaggcgaaaatgatatgctgaaggaaatcaccgatgtgcattcaaaagtcattcgactagtgaagtatgctgaaaccgtggagccgtttattggaagcatcgaagcaattgatatacctcaagtgaacaaagatgtgaagatctctgagatggacataatggaatctttgctacacaacatgacattgctgtcgtccaaaatatcaacgctgaaagaattgtataaactgatgaatactttgaaaatcgaggaaaaccagaaaaagttagctgaaatggtcagaattgctagtgttactggagacaagctcaagttgtaccgaggaagtcaagaattcaaggatattcactaattgcttctaccaatgcatgacgcgtat