Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:329A9   

TH:329A9RNAiTH:329A9
PCR_productTH:329A9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G7.11 Source_evidenceePCR338WS150 Sequence/Annotation Release
Overlaps_Gene K04G7.11 Source_evidenceePCR392WS150 Sequence/Annotation Release
Chunk_score Abs_score350
Max_abs_score350K04G7.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII71616017162236
Overlaps_transcriptK04G7.11 Source_evidenceePCR392WS150 Sequence/Annotation Release
WB_DNA_textTH:329A9636gcagcagtcaggcgagtatgttgacgaagagtcatatcttcgtaagaagtaaatccttgatctgggttcttctttctctttcttttttgctcaagcttctcagtaacatctgcagacatctctaaactgcgaacacgttcatagtccaatcccttgtcttctgcagcttttcgatcttgtagctctttaacctgccattgatctctttccttttttgcttcgtggttttttggaagtttgctgcgacgatcttcttcaacgacctacaattttaaattataattgaaaatgtaaacgttaaaacactaacctgttcgtgattctcttttctcgctctttggcggagtttgtgaagatcacggaacctctgattgaaatccttcatttttgatccactggacgacggcccactgctgctcgattgtgattcggaagacatctaggaaaaagtgttgaagagaaatccagaaagttgagaagaaaagctacattgaaacggaatacagaatattttgaacatcagaaaaagaagaaccgatatgatttgaattcatttacaatctatattttttaaaccgatagttacatgttcaaaacatattaatactatccagctttgcgaaacaaagaaggctt