Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:329F9   

TH:329F9RNAiTH:329F9
PCR_productTH:329F9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene (3)
Overlaps_transcript T07C4.1.1 Source_evidenceePCR77WS150 Sequence/Annotation Release
T07C4.3b Source_evidenceePCR152WS150 Sequence/Annotation Release
T07C4.4.2 Source_evidenceePCR351WS150 Sequence/Annotation Release
T07C4.4.1 Source_evidenceePCR498WS150 Sequence/Annotation Release
WB_DNA_textTH:329F9934ccttctaccgtgtgtggttttctagtttacgtgttctcagggtagctgagaacttttcccccattcaacaactagaaccaacacgagttctaattttaataactctaaaattccacgcgcacaaaccaatttcgccgttgtttctgtttttgttaaatgaaagaatattttgatgattttgaaggaaacatttattattcttagcacaaatcaacatccttgcacgccttgtctggagaatccttgttctcaatatcctttttcagctccttcttgaccttcttcagctcttcctcacactcgtgatgcaacggcaacagcatagtccagcaaagagttccgatgttcacatcaagccatgcatcgagatcatcatctccaaccttctctccaccctgaaatatgtgaataacgaggaaaattggagatatttggagcacaaacctcgacgagagccttgcagacatcacagaaaacaccgtgatgcttcttgagattgagtgggttagctggattggctagaagtggagcagcggcgagcaagacaaggaaaagacacggaagaatgcgagtcattctgtagattttaagatgaaaaactggagaaatgaagcgaaaatgcacccggagcagtgatgctcgtgtcttttatcaacttcgcggcggcactgataaggaatcgaatcgtttctgatgttttcagcatggaggaaaagatcaaaggacattatagaatacacaccgggtcgttcacacatcagatgccgatttttcgaactgataagatcgcttagaggagtagcttttcgccttgacggagaaaatattgattaatcaggttagcagtaaagtaaatggtgtgggcatgtgatttcttgataatttgaggaagatggaggcaatcaatttacttatttcaacaattctggggaag