Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:329H8   

TH:329H8RNAiTH:329H8
PCR_productTH:329H8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35G12.7 Source_evidenceePCR339WS150 Sequence/Annotation Release
Overlaps_Gene F35G12.7 Source_evidenceePCR407WS150 Sequence/Annotation Release
Chunk_score Abs_score323
Max_abs_score323F35G12.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII45864514587191
Overlaps_transcriptF35G12.7 Source_evidenceePCR407WS150 Sequence/Annotation Release
WB_DNA_textTH:329H8741tagccctgtctttcccgttcaactcgatctctttgaaaaaaattcattaaatcacatcagaatcgctcgaaaaaaaaatttgaagctttcaagacaatccccaaaaaagcatgctcaaatcgttattttggaatcttcaaattttcggagcattttttcttattacgatgtttttttccttagccaaatctgtttgtatgtatttatcagttcccgttgatttaatgtttagttggtagaaataaatatgaataaagttttaagtttcaatgtttcgcagttgaagaattcgtagaatccacaatccatcctccaaaatcgggagttattttgtcaatggccagtgtgaagaagcacggagtttcagccggatgaagagatcgaacacgctgaaattgaatgaaaatcttagtgatccgaaataaaaacatacagctgatagctcttcgactttgctttctacagttttcaagatcacgacatgctcttgatcttcttcaatttttccttgccatttgtatctgaatatctggattctcgcacagatttaaaaaagataaaatacttacacagatgtgacttccggaataacattggcgcaagcggctaatgcttcagtgacagttgttctgaaatgaaattatgttttggtagacagaaaacaaaaaaataccttgccacagtcattgcaacttccttactcggagctgtcacatacgcgacaaccatttttacagcggg