Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:329a6   

TH:329a6RNAiTH:329a6
PCR_productTH:329a6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK1010.1 Source_evidenceePCR418WS150 Sequence/Annotation Release
Chunk_score Abs_score355
Max_abs_score355ZK1010.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1297750212978364
Overlaps_transcript (2)
WB_DNA_textTH:329a6863acatggactggaacgagtgaagattacttcagcttcttcttgatgcggagctcgctggagtgtccgcacttcttctttctgcagttgctggcacgtggtgggagacgagcatagcactttctgcagatctgcttgtcgcagttgtacttctgggcgagctgacggagagatggctcgatgattcctgaatttagaaatatttctcaatgcctgaacattagaaaaaaactaacctccacgaagacggagcaccaagtggagagtagactccttttggatgttgtagtcggagagagtacgtccatcctcgagttgctttcctgaaattagaaaattatattgggtgttttgcccggaaattaattcaagaatatatcaggtctgaataataacgtaccggcgaagatcaatctttgctgatctggtgggattccctccttgtcttggatcttggccttgacattctcaatggtatcggaagcctcgacttcgagggtaatagtcttacccgtcagagtcttgacgaagatttgcatgactgaaattatataatttgaaaagaaaccgagtaaaattgtcagaaaatgacggcgagagcgaaacatttggaggagagcgtaggggcaaaaattattgatttttctttagagactagtttcaaaggtgacaaaagacgttatagaccgcataatgtgtgtaactacccatttagaacaaagaggaaagaatattttgcgttaaaaagctgtaaaaattcaagaatagagaaattatttagcaaaaaaatgaaatttcataataaattcgttttccaagcttaaaatacaacagaatctccactttctatgctgaacaagcgtcca