Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:330A5   

TH:330A5RNAiTH:330A5
PCR_productTH:330A5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0524.2 Source_evidenceePCR460WS150 Sequence/Annotation Release
Overlaps_Gene B0524.2 Source_evidenceePCR460WS150 Sequence/Annotation Release
Chunk_score Abs_score397
Max_abs_score397B0524.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII18972391898899
Overlaps_transcriptB0524.2 Source_evidenceePCR460WS150 Sequence/Annotation Release
WB_DNA_textTH:330A51661ggcggtcgaggaaatctataaaatggccgatgaggtgaacgacaaaacgctcggcgcaatgtctccgggattcgttatcagtgatcgtttgcggaaagtcgtcgaaaaattcctacctgatgacgtggcaaaggcaaacgatctgctttttgtgtcggtcaccaagttgaaggtgctgattttatcgattttttcacggaaaaattccgaaaattcccacttttagacatggaaaaacgagctgatctcgaatttcgagtcgaaaatcgatttgatcgattgtctgatggcgagctgctatcatccaatgtactcgtcgggtttgaacggaaaagcgccgattcttcggggagaggtaacgttttttttttaatttcgaaggagtaaaaactatgtgaaaattcgaattcagctcgttaagagctttcagaagagcctgatattgacttttgtgttttttgggccccgacacgaaaaccccgggttactgtagtttaaaggcacatgggcgagtcgaaattttgaaatttgaatttctcacactctgagctctcatttgacccccatattgactagattccatcgattttgaaagttaattgggtctcgccgtgaaaactacagtaaccccggtcgggttttcgttgcgagaccctggaaactttgaaatgggaaaactaacgaaaaattcgaattcagctctacgagagctttcaaatgacctccatattgactaggtttcgataattttgaaaaacaattgggtcccaccgcgaaaactacggtaaccccggcgggttttcgtggcgagacccgaaaacgttcaaaactgttggaacctagctattaggggtttatttgaacaccagtaaaccgctgagctcgaaaattacacttaaaatcggtttatgcccctcctgcgattttaaactaaagtaaccctgcgagttttcgtggcgagacccaaaaaaattggaaattagtaaaaactcattttattgtctagaatagacaaaatacaagttttcaaacaaaaagttagcaaaaaagctcaaaattgaacaaagttgtcgattttcgaaatttcttcatctaattttgggtcctgccacgaaaaccccgggttactgtaggcttgcaacctggcaaacggcttaaactatttttcttggtaagaatagataaaaccctatttttgaagacaaaaaaccctgagaaatcttgaaaatgagcaaagttatcgattttcgaaacttttcgaatttttttgaaattttttagaatttatcgatttttcagggtttttcctggacaagtttatactttttgaaaagctctcgacaagctgaactcaaattttaggcttaacactccctaaacccctaacatttccaggcatacatcgacggtggctactcgaacatgattccagagttccttgacatgcgtacggtcacagtgtctgcatttgccggtgatgcggacatttgtcccgtcgagaaatctgcattgttcaatgattttatgttcgcattctttaatcagaatatgaaggtgattttttaaggcaaatttgaaaattttggatattttcattattaaattcgaattcctcgtctaatttcaccctagcagccttttattctgggcctctagctcaa