Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:330B5   

TH:330B5RNAiTH:330B5
PCR_productTH:330B5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0524.6 Source_evidenceePCR362WS150 Sequence/Annotation Release
Overlaps_Gene B0524.6 (3)
B0524.1 Chunk_score Abs_score67
Specificity_index0.183
Rel_score0.223
Overlaps_transcriptB0524.6 Source_evidenceePCR362WS150 Sequence/Annotation Release
WB_DNA_textTH:330B51748caaaaatgaaatttcccgcattttttgctcagaaattcaaatttttcgctaaaaatcaagtttttagactaaaaaatcgaatttttcaggtttttgaactgataaaacctgatttttaagctcaaaaaaaatttttttaggtcgaaaatcagaaaattattctatttcaggtgcttttagagctgaaaatatggaattttcagctcaaaaattcgatttttattcaatttttcgtttttttagggtcaaaaatgcaatttttctcgcttttttcgcctaaaaacctaccaaaatcagccaaaagcgtcatttgtgacagtgtctgatagtacattttacacgcttcactgtaacttattacaggagactgtggtggtggtggagcaattggctccaaaaccattggttcaaccggttcaattgattttttaacgggatttcgtcctttttccgccgaattttgtggtttttgggcacattttatcggttttacgacgattctggcgtgtttttggggttttcgaaggtgttggacggttttttgaaccatttcctcgatttttatgggaattggcggtggttttgatgtcggaagtgagatttttggctctgctgcggtgggtggaagtcgtgatggaagtgttggagggctgaaaaatccttttttttcaattttttgtgaaaattttgcagttttagagtgaaaaatcatcattttttgcgctttttaagctcaaaattcggatttagaagcgttttttaggcatttttcgcgaaattctgcatttttccgtaagatccgcggtgtttgcgtacttctggagctaccgtaacccgaaaagttcaaatttcgagctagaagcccggcgaaaagaggttttagggtaaaaaaccatgaaaaaatcgaagttcataatgaaaattttcaaaaatcgggttaaaaaaaatttgggcaagtttttgactgaaaattgaaaatttgggcatagcttccgcatctccgagtgacaaatgtgctctattgtcaaattgttggcagaaatacggtatttattcacattttcagccaatttaaggcagaaaatgtgaataagtacccgtttttatgccaacaatacgagtagaaacacacaagtcacaggggaaatatatcgatttctagtagattttacggatttaaattgaaaattttgcaattttcaagtaaaaatccaaaaaaatcgctacaaaatggctagaaacgatcattttcagattggtgacctagaaatgtcaaaagttagaccatcaatctattttgtgcaaaaaaagcaatttctatgggtaaaaatgagtgaaaaactcaatttttaactgaaaattcgagaaaaatcgatagaaatggcaagttttccgggaaaaattgcaaaatttgggcatagcttccgcatctccgagtgacaaatgtgctctattgtcaaattgtttgcagcaatacggtaattattcacattttcaggcaaatttaaggctgaaaatgtgaataaatacccgtttttatgccatcaatacgagtagaaacacacaagtcactgagaaaaagttaaaaaaaattaaatttttgaaatatctgcggggattgaggcattttttactgattttaagctcaaaattcagattcaaaataattttttacccctatccagccatttttcgtaagatctgtagtgtttgcgtacttctgaggctgccgtaacccgaaaagttca